This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

78 entries
entries per page


Exon Hide Exon column Descending
Ascending

Legacy DNA ID Hide Legacy DNA ID column Descending
Ascending

DNA change   Descending
Ascending

RNA change Hide RNA change column Descending
Ascending

Protein change Hide Protein change column Descending
Ascending

RNA information Hide RNA information column Descending
Ascending

Protein information Hide Protein information column Descending
Ascending

DB-ID Hide DB-ID column Descending
Ascending

Location Hide Location column Descending
Ascending

Base number Hide Base number column Descending
Ascending

5' Sequence Context Hide 5' Sequence Context column Descending
Ascending

Original Sequence Hide Original Sequence column Descending
Ascending

Variant Sequence Hide Variant Sequence column Descending
Ascending

3' Sequence Context Hide 3' Sequence Context column Descending
Ascending

Type Hide Type column Descending
Ascending

Domain Hide Domain column Descending
Ascending

Detection Method Hide Detection Method column Descending
Ascending

RE Site Hide RE Site column Descending
Ascending

Frequency Hide Frequency column Descending
Ascending

Remarks Hide Remarks column Descending
Ascending
01 - Whole gene deletion
  (Reported 12 times)
r.0 p.0 No transcription No translation SOX2_00001 Whole Gene - - - - - Deletion - FISH - - Patient has a 600kb deletion (encompassing the whole SOX2 gene) and a t(3;11) translocation
01 - Whole gene deletion chr3:180,960,157-184,754,546 r.0 p.0 No transcription No translation SOX2_00083 Whole gene - - - - - Deletion - CGH - - -
01 - Whole gene deletion chr3:181,012,354-185,302,035 r.0 p.0 No transcription No translation SOX2_00087 Whole gene - - - - - Deletion - Other - - Deletion detected by QMPSF
01 - Whole gene deletion chr3:181,292,708_182,858,976 r.0 p.0 No transcription No translation SOX2_00124 Whole Gene - - - - - Deletion - CGH - - Patient has a 1.5-2Mb deletion
01 - Whole gene deletion chr3:181216930-189014508 r.0 p.0 No transcription No translation SOX2_00039 Whole Gene - - - - - Deletion - FISH - - Patient has a 7.8Mb deletion (detected by FISH, confirmed by CGH)
01 - Whole gene deletion chr3:181225746_181460587 r.0 p.0 No transcription No translation SOX2_00123 Whole Gene - - - - - Deletion - CGH - - Patient has a 235kb deletion
01 - Whole gene deletion chr3:182,775,402-183,101,622 r.0 p.0 No transcription No translation SOX2_00085 Whole gene - - - - - Deletion - Other - - Detected by QMPSF
01 - Whole gene deletion chr3:182,877,971-182,958,506 r.0 p.0 No transcription No translation SOX2_00086 Whole gene - - - - - Deletion - Other - - Detected by QMPSF
01 - Whole gene deletion chr3:182649000-184339000 r.0 p.0 No transcription No translation SOX2_00081 Whole Gene - - - - - Deletion - CGH - - 1.6 Mb deletion (encompassing the whole SOX2 gene)
01 - 3' gene deletion r.? p.? Effect on transcription unknown Effect on translation unknown SOX2_00033 Exon - - - - - Deletion Unknown MLPA - - 3' end of gene deleted; proximal breakpoint between bases 154-698
01 - c.16G>T - p.(Glu6*) Glu (gag) > Ter (uag) predicted Termination of translation predicted SOX2_00058 ORF exon 16 ATGATG G T AGACGG Substitution N-terminal domain Direct Sequencing - - -
01 - c.53C>A
  (Reported 2 times)
- p.(Ser18*) Ser (ucg) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00027 Exon 53 AAACTT C A GGGGGG Substitution NTD Direct Sequencing - - -
01 - c.58_59dupGG - p.(Gly21Argfs*75) Predicted frame-shifting duplication of 2 bases Truncated protein predicted SOX2_00057 ORF exon 58 GGGGGG - GG CGGCGG Duplication N-terminal domain Direct Sequencing - - Replication slippage likely
01 - c.62dupG - p.(Gly22Argfs*74) Predicted frameshift leading to PTC Truncated protein has impaired nuclear localization and no DNA binding or transactivation activity SOX2_00017 Exon 62 GGGCGG - G CGGCGG Duplication NTD Direct Sequencing - - -
01 - c.67_69dupGGC - p.(Gly33_Asn34insGly) In-frame duplication of 3 bases Insertion of Glycine in a run of Glycines SOX2_00065 ORF exon 67 GGCGGC - GGC AACTCC Duplication N-terminal domain Direct Sequencing - - -
01 - c.67_89del23 - p.(Gly23Argfs*65) Frameshifting deletion predicted Truncated protein predicted SOX2_00007 Exon 67 GGCGGC GGCAACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD DHPLC - - Deleted sequence is in triplet repeat region - replication slippage likely
01 - c.70_86del17
  (Reported 3 times)
- p.(Asn24Glyfs*66) Frame-shifting deletion predicted PTC predicted SOX2_00088 ORF exon 70 GGCGGC AACTCCACCGCGGCGGC - GGCCGG Deletion N-terminal Direct Sequencing - - -
01 - c.70_89del20
  (Reported 15 times)
- p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00011 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely
01 - c.86_95dup10 - p.(Asn33Glyfs*66) Frame-shifting duplication predicted PTC predicted SOX2_00089 ORF exon 86 CGGCGG CGGCCGGCGG CGGCCGGCGGCGGCCGGCGG CAACCA Duplication N-terminal Direct Sequencing - - -
01 - c.131C>G - p.(Pro44Arg) Pro (ccc) > Arg (cgc) predicted HMG missense mutation predicted SOX2_00066 ORF exon 131 AGCGGC C G CATGAA Substitution HMG Direct Sequencing - - -
01 - c.138T>G - p.(Asn46Lys) Asn (aau) > Lys (aag) predicted Predicted missense change in HMG box SOX2_00012 Exon 138 CATGAA T G GCCTTC Substitution HMG DHPLC StuI+ - Mutation inherited from normal mother (presumed gonosomal mosaic)
01 - c.138_140dupTGC - p.(Ala47dup) In-frame insertion predicted Duplication of Ala 47 predicted in HMG domain SOX2_00075 ORF exon 138 CATGAA TGC TGCTGC CTTCAT Duplication HMG Direct Sequencing - - -
01 - c.143_144delTCinsAA - p.(Phe48*) Phe (uuc) > Ter (uaa) predicted Premature termination of translation predicted within HMG domain. Truncated protein has impaired nuclear localisation and transcriptional control activity. SOX2_00071 ORF exon 143 ATGCCT TC AA ATGGTG Insertion/Deletion HMG Direct Sequencing - - -
01 - c.151T>C - p.(Trp51Arg) Trp (ugg) > Arg (cgg) predicted Missense change affecting highly conserved residue in HMG box SOX2_00090 ORF exon 151 ATGGTG T C GGTCCC Substitution HMG Direct Sequencing - - -
01 - c.158_174delinsATG - p.(Arg53Hisfs*37) Frame-shifting indel predicted PTC predicted SOX2_00091 ORF exon 158 GGTCCC GCGGGCAGCGGCGCAAG ATG ATGGCC Insertion/Deletion HMG Direct Sequencing - - -
01 - c.163C>T - p.(Gln55*) Gln (cag) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00014 Exon 163 CGCGGG C T AGCGGC Substitution HMG DHPLC - - -
01 - c.181C>T - p.(Gln61*) Nonsense mutation Gln (cag) > Ter (tag) predicted Truncated protein does not bind DNA or repress beta-catenin-mediated trasncription SOX2_00040 Exon 181 ATGGCC C T AGGAGA Substitution HMG Direct Sequencing BfaI+ - -
01 - c.188delA - p.(Asn63Thrfs*40) Predicted frameshift leading to PTC Truncated protein predicted SOX2_00028 Exon 188 AGGAGA A - CCCCAA Deletion HMG Direct Sequencing - - -
01 - c.200delA - p.(His67Profs*36) Frame-shifting deletion predicted PTC predicted SOX2_00092 ORF exon 200 AGATGC A - CAACTC Deletion HMG Direct Sequencing - - -
01 - c.221G>C
  (Reported 2 times)
- p.(Arg74Pro) Arg (cgc) > Pro (ccc) predicted Missense change in HMG domain predicted SOX2_00015 Exon 221 GCAAGC G C CCTGGG Substitution HMG DHPLC - - -
01 - c.224T>A - p.(Leu75Gln) Leu (cug) > Gln (cag) predicted Missense protein has reduced DNA binding and transactivation activity SOX2_00026 Exon 224 AGCGCC T A GGGCGC Substitution HMG Direct Sequencing - 0/200 -
01 - c.235C>T - p.(Trp79Arg) ugg (Trp) > cgg (Arg) predicted Missense change predicted. Mutant protein has reduced in vitro transactivating activity SOX2_00103 ORF exon 235 GCCGAG T C GGAAAC Substitution HMG Direct Sequencing - - -
01 - c.236G>C - p.(Trp79Ser) Trp (ugg) > Ser (ucg) predicted Substitution of invariant Trp predicted SOX2_00094 ORF exon 236 CCGAGT G C GAAACT Substitution HMG Direct Sequencing - - -
01 - c.244_245delTT
  (Reported 3 times)
- p.(Leu82Valfs*13) Frame-shifting deletion predicted Truncated protein predicted SOX2_00076 ORF exon 244 AAACTT TT - GTCGGA Deletion HMG Direct Sequencing - - -
01 - c.245delT - p.(Leu82Cysfs*20) Frame-shifting deletion predicted PTC predicted SOX2_00095 ORF exon 245 AACTTT T - GTCGGA Deletion HMG Direct Sequencing - - -
01 - c.248C>A - p.(Ser83*) Set (ucg) > Ter (uag) predicted HMG nonsense mutation - truncated protein predicted SOX2_00003 Exon 248 TTTTGT C A GGAGAC Substitution HMG DHPLC - - -
01 - c.255_256delGGinsT - p.(Glu86Argfs*17) Frame-shifting indel predicted PTC predicted SOX2_00096 ORF exon 255 GGAGAC GG T AGAAGC Insertion/Deletion HMG Direct Sequencing - - -
01 - c.277G>T
  (Reported 3 times)
- p.(Glu93*) Glu (gag) > Ter (uag) predicted HMG box nonsense mutation - truncated protein predicted SOX2_00002 Exon 272 ATCGAC G T AGGCTA Substitution HMG DHPLC MaeI+ - -
01 - c.285dupG - p.(Arg96Alafs*14) Frameshifting insertion predicted Frameshift creates PTC - truncated protein predicted SOX2_00032 Exon 285 GCTAAG - G CGGCTG Duplication HMG Direct Sequencing - - -
01 - c.290T>C - p.(Leu97Pro) Leu (cug) > Pro (ccg) missense change predicted Predicted amino acid substitution in HMG box SOX2_00008 Exon 290 AGCGGC T C GCGAGC Substitution HMG DHPLC - - -
01 - c.302A>G - p.(His101Arg) Missense change His (cac) > Arg (cgc) predicted Substitution of invariant amino acid in HMG domain predicted SOX2_00077 ORF exon 302 CGCTGC A G CATGAA Substitution HMG Direct Sequencing - - -
01 - c.310G>T
  (Reported 2 times)
- p.(Glu104*) Glu (gag) > Ter (uag) predicted Truncated protein predicted SOX2_00048 ORF exon 310 ATGAAG G T AGCACC Substitution CTD Heteroduplex Analysis - 0/80 -
01 - c.329A>G - p.(Tyr110Cys) Tyr (uac) > Cys (ugc) predicted Missense mutation of invariant cysteine predicted. Mutatn protein has reduced DNA binding and transactivation activity SOX2_00102 ORF exon 329 ATAAAT A G CCGGCC Substitution - Direct Sequencing - 0/150 -
01 - c.355C>T - p.(Pro112Leu) Pro (ccc) > Leu (cuc) Amino acid substitution predicted SOX2_00122 ORF exon 335 ACCGGC C T CCGGCG Substitution - Other - - Whole exome sequencing
01 - c.368A>G
  (Reported 2 times)
- p.(Asp123Gly) Asp (gau) > Gly (ggu) predicted Missense substitution of highly conserved aspartate residue predicted SOX2_00056 ORF exon 368 AGAAGG A G TAAGTA Substitution C-terminal domain Direct Sequencing - - -
01 - c.387C>G - p.(=) Gly (ggc) > Gly (ggg) predicted No effect predicted SOX2_00024 Exon 387 GCCCGG C G GGGCTG Substitution CTD Direct Sequencing - 0/100 Variant inherited from unaffected father
01 - c.387delC - p.(Leu131Cysfs*23 Predicted frameshift leading to PTC Truncated protein has impaired transactivation activity SOX2_00019 Exon 387 GCCCGG C - GGCTGC Deletion CTD Direct Sequencing - - -
01 - c.389G>C - p.(Gly130Ala) Missense change Gly (ggg) > Ala (gcg) predicted Nuclear localization, DNA binding and transactivation activity unaffected SOX2_00023 Exon 389 CCGGCG G C GCTGCT Substitution CTD Direct Sequencing BssHII+ 0/100 Variant inherited from unaffected father
01 - c.402delC - p.(Gly135Alafs*19) Frame-shifting deletion predicted Truncated protein predicted. Mutant protein has reduced in vitro transactivating activity SOX2_00108 ORF exon 402 GGCCCC C - GGCGGC Deletion CTD Direct Sequencing - - -
01 - c.453G>A - p.(=) Ala (gcg) > Ala (gca) predicted No change expected SOX2_00045 Exon 453 GGGCGC G A GGCGTG Substitution CTD Direct Sequencing - - Presumed neutral variant
01 - c.463C>T - p.(Gln155*) Gln (cag) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00010 Exon 463 GTGAAC C T AGCGCA Substitution CTD SSCP MaeI+ 0/142 -
01 - c.479delA - p.(Tyr160Serfs*4) Frameshifting deletion predicted Truncated protein has impaired transactivation activity SOX2_00022 Exon 479 ACAGTT A - CGCGCA Deletion CTD Direct Sequencing - - -
01 - c.479dupA
  (Reported 2 times)
- p.(Tyr160*) Insertion creates immediate PTC Truncated protein has impaired transactivation activity SOX2_00020 Exon 479 CAGTTA - A CGCGCA Duplication CTD Direct Sequencing HpaI+ - -
01 - c.479_480dupAC - p.(Ala161Thrfs*4) Frame-shifting insertion predicted Truncated protein predicted SOX2_00079 ORF exon 479 ACAGTT AC ACAC GCGCAC Substitution C-terminal Direct Sequencing - - -
01 - c.480C>G
  (Reported 3 times)
- p.(Tyr160*) Tyr (uac) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00030 Exon 480 CAGTTA C G GCGCAC Substitution CTD Direct Sequencing - - -
01 - c.481G>T - p.(Ala161Ser) Ala (gcg) > Ser (ucg) predicted Missense change predicted (Ala is conserved at this position in all vertebrates) SOX2_00115 ORF exon 481 AGTTAC G T CGCACA Substitution - Direct Sequencing - - -
01 - c.486_487dupCA - p.(Met163Thrfs*2) Predicted frameshifting insertion, followed immediately by termination codon. Termination of translation predicted SOX2_00062 ORF exon 486 CGCGCA - CA TGAACG Duplication C-terminal domain Direct Sequencing - - -
01 - c.513C>G - p.(Tyr171*) Nonsense mutation predicted PTC predicted SOX2_00099 ORF exon 513 CAGCTA C G AGCATG Substitution CTD Direct Sequencing - - -
01 - c.529C>T
  (Reported 3 times)
- p.(Gln177*) Gln (cag) > Ter (uag) predicted Truncated protein predicted SOX2_00004 Exon 529 CAGGAC C T AGCTGG Substitution CTD DHPLC AvaI-, BfaI+ - -
01 - c.540C>G - p.(Tyr190*) Nonsense mutation Tyr (uac) > Ter (uag) predicted Truncated protein predicted SOX2_00063 ORF exon 540 GGGCTA C G CCGCAG Substitution C-terminal domain Direct Sequencing - - -
01 - c.542delC - p(Pro181Argfs*22) Frame-shifting deletion predicted Truncated protein predicted SOX2_00072 ORF exon 542 GCTACC C - GCAGCA Deletion - Direct Sequencing - - -
01 - c.551delC - p.(Pro184Argfs*19) Frameshifting deletion leads to premature stop codon Truncated protein predicted SOX2_00049 ORF exon 551 AGCACC C - GGGCCT Deletion CTD Heteroduplex Analysis - 0/80 Mutation inherted from normal mother
01 - c.561T>C - p.(=) Asn (aau) > Asn (aac) predicted No effect predicted SOX2_00044 Exon 561 CCTCAA T C GCGCAC Substitution CTD Direct Sequencing - - Presumed neutral variant
01 - c.571G>A - p.(Ala191Thr) Missense change predicted: Ala (gca) > Thr (aca) Nuclear localization, DNA binding and transactivation activity unaffected SOX2_00025 Exon 571 CACGGC G A CAGCGC Substitution CTD Direct Sequencing HhaI- 0/100 Variant inherited from unaffected father
01 - c.599delA - p.(Tyr200Serfs*3) Frame-shifting deletion predicted PTC predicted SOX2_00100 ORF exon 599 ACCGCT A - CGACGT Deletion CTD Direct Sequencing - - -
01 - c.628delA - p.(Met210*) Frameshifting deletion creates immediate PTC Truncated protein predicted SOX2_00009 Exon 628 AACTCC A - TGACCA Deletion CTD DHPLC NlaIII- - -
01 - c.695C>A - p.(Thr232Asn) Thr (acc) > Asn (aac) predicted Missense change predicted SOX2_00047 ORF exon 695 AGGGCA C A CCCTGG Substitution CTD Direct Sequencing - 0/103 -
01 - c.834C>T - p.(=) Leu (cuc) > Leu (cuu) predicted No change expected SOX2_00046 Exon 834 GTATCT C T CCCGGC Substitution NTD Direct Sequencing - - -
01 - c.837delC - p.(Gly280Alafs*91) Frame-shifting deletion predicted Out-of-frame extension into 3'UTR predicted SOX2_00070 ORF exon 837 TCTCCC C - GGCGCC Deletion NTD Direct Sequencing - - -
01 - c.841_651del11insA - p.(Ala281Argfs*87) Frame-shifting deletion predicted Translation into 3'UTR predicted SOX2_00080 ORF exon 841 CCCGGC GCCGAGGTGCC A GGAACC Insertion/Deletion C-terminal Direct Sequencing - - -
01 - c.859G>C - p.(Ala287Pro) Ala (gcc) > Pro (ccc) predicted Missense change in C-terminal domain SOX2_00067 ORF exon 859 GAACCC G C CCGCCC Substitution C-terminal domain Direct Sequencing - - -
01 - c.905delC - p.(Pro302Argfs*69) Frame-shifting deletion predicted Translation into 3'UTR predicted SOX2_00101 ORF exon 905 GCGGCC C - GGTGCC Deletion - Direct Sequencing - 0/6500 -
01 - c.940delC - p.(Leu314Serfs*57) Frame-shifting deletion at C-terminal end of ORF Translational run-on into 3'UTR predicted SOX2_00064 ORF exon 940 TGCCCC C - TCTCAC Deletion C-terminal domain Direct Sequencing - - Deletion of a C from a run of C's - replication slippage likely
01 - c.943_944delTC - p.(Ser315Thrfs*112) Frameshifting deletion predicted Translation into 3'UTR predicted SOX2_00006 Exon 943 CCCCTC TC - ACACAT Deletion CTD DHPLC - - Deletion of TC from TCTC motif
01 - c.*22G>A
  (Reported 2 times)
- - Presumed neutral substitution at base 22 of 3'UTR No effect predicted SOX2_00042 3' UTR 976 CTGGAG G A GGGGAG Substitution - DHPLC - 5/88 3'UTR polymorphism
01 - c.*26dupG - p.(=) Single nucleotide insertion in 3'UTR predicted No effect predicted SOX2_00116 3' UTR - GGGGGG - G AGAAAT Duplication - Direct Sequencing - - -
01 - c.*469C>A
  (Reported 2 times)
- - 3'UTR change - no effect predicted No effect predicted SOX2_00051 3' UTR 1850 AAGCAA C A TTTTGT Substitution 3'UTR Heteroduplex Analysis - - Probable 3'UTR polymorphism
01 - c.*557G>A - - 3'UTR change - no effect predicted based on current evidence No effect predicted SOX2_00050 3' UTR 1938 AGGAGA G A GCTTCT Substitution 3'UTR Heteroduplex Analysis - 0/80 Mutation unlikely to be causative based on current knowledge
1 - 78

Save Click here to save this list in a tab-delimited text file.

Legend: [ SOX2 full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Coding DNA Reference Sequence, with the first base of the Met-codon counted as position 1.
Exon: Exon number (always '01' for SOX2) Legacy DNA ID: This column is not used in the SOX2 database DNA change: Variation at DNA level (see full legend for details and examples). RNA change: Variation at RNA level (see Full Legend for examples) Protein change: Variation at protein level (see Full Legend for details and examples) RNA information: Additional information about RNA change Protein information: Additional information about protein change SOX2 DB-ID: Database IDentifier; unique identifier for each sequence variant Location: Variant location within the gene Base number: Position of change within cDNA 5' Sequence Context: Six bases immediately 5' of the change Original Sequence: The original (wild type) sequence Variant Sequence: The new (mutant or variant) sequence 3' Sequence Context: Six bases immediately 3' of the change Type: Type of variant at DNA level Domain: SOX2 protein domain: NTD (N-terminal domain), HMG (HMG box) or CTD (C-terminal domain) Detection Method: Technique used to detect the mutation RE Site: Variant creates (+) or destroys (-) a restriction enzyme recognition site Frequency: Frequency of polymorphism/variant Remarks: Any other comments