Search unique variants - MRC Human Genetics Unit LOVD at MRC IGMM

About this overview [Show]

The variants below are all in the SOX2 database, matching your query. In this view only variant fields are shown. Variants are listed only once, a number is present in the DNA change field when a variant has been reported more than once (in such cases fields other than the DNA change just belong to one entry and may differ for other entries).
Selecting and clicking a specific line will open a detailed view showing all variant entries, including patient and pathogenicity information.
At the bottom of this page a legend is provided with a short explanation of what each field contains.
For a more detailed description of each field, please see the SOX2 full legend here.

78 entries
entries per page

Exon

Legacy DNA ID

DNA change

RNA change

Protein change

RNA information

Protein information

DB-ID

Location

Base number

5' Sequence Context

Original Sequence

Variant Sequence

3' Sequence Context

Type

Domain

Detection Method

RE Site

Frequency

Remarks


01	-	Whole gene deletion (Reported 12 times)	r.0	p.0	No transcription	No translation	SOX2_00001	Whole Gene	-	-	-	-	-	Deletion	-	FISH	-	-	Patient has a 600kb deletion (encompassing the whole SOX2 gene) and a t(3;11) translocation
01	-	Whole gene deletion chr3:180,960,157-184,754,546	r.0	p.0	No transcription	No translation	SOX2_00083	Whole gene	-	-	-	-	-	Deletion	-	CGH	-	-	-
01	-	Whole gene deletion chr3:181,012,354-185,302,035	r.0	p.0	No transcription	No translation	SOX2_00087	Whole gene	-	-	-	-	-	Deletion	-	Other	-	-	Deletion detected by QMPSF
01	-	Whole gene deletion chr3:181,292,708_182,858,976	r.0	p.0	No transcription	No translation	SOX2_00124	Whole Gene	-	-	-	-	-	Deletion	-	CGH	-	-	Patient has a 1.5-2Mb deletion
01	-	Whole gene deletion chr3:181216930-189014508	r.0	p.0	No transcription	No translation	SOX2_00039	Whole Gene	-	-	-	-	-	Deletion	-	FISH	-	-	Patient has a 7.8Mb deletion (detected by FISH, confirmed by CGH)
01	-	Whole gene deletion chr3:181225746_181460587	r.0	p.0	No transcription	No translation	SOX2_00123	Whole Gene	-	-	-	-	-	Deletion	-	CGH	-	-	Patient has a 235kb deletion
01	-	Whole gene deletion chr3:182,775,402-183,101,622	r.0	p.0	No transcription	No translation	SOX2_00085	Whole gene	-	-	-	-	-	Deletion	-	Other	-	-	Detected by QMPSF
01	-	Whole gene deletion chr3:182,877,971-182,958,506	r.0	p.0	No transcription	No translation	SOX2_00086	Whole gene	-	-	-	-	-	Deletion	-	Other	-	-	Detected by QMPSF
01	-	Whole gene deletion chr3:182649000-184339000	r.0	p.0	No transcription	No translation	SOX2_00081	Whole Gene	-	-	-	-	-	Deletion	-	CGH	-	-	1.6 Mb deletion (encompassing the whole SOX2 gene)
01	-	3' gene deletion	r.?	p.?	Effect on transcription unknown	Effect on translation unknown	SOX2_00033	Exon	-	-	-	-	-	Deletion	Unknown	MLPA	-	-	3' end of gene deleted; proximal breakpoint between bases 154-698
01	-	c.16G>T	-	p.(Glu6*)	Glu (gag) > Ter (uag) predicted	Termination of translation predicted	SOX2_00058	ORF exon	16	ATGATG	G	T	AGACGG	Substitution	N-terminal domain	Direct Sequencing	-	-	-
01	-	c.53C>A (Reported 2 times)	-	p.(Ser18*)	Ser (ucg) > Ter (uag) predicted	Nonsense PTC - truncated protein predicted	SOX2_00027	Exon	53	AAACTT	C	A	GGGGGG	Substitution	NTD	Direct Sequencing	-	-	-
01	-	c.58_59dupGG	-	p.(Gly21Argfs*75)	Predicted frame-shifting duplication of 2 bases	Truncated protein predicted	SOX2_00057	ORF exon	58	GGGGGG	-	GG	CGGCGG	Duplication	N-terminal domain	Direct Sequencing	-	-	Replication slippage likely
01	-	c.62dupG	-	p.(Gly22Argfs*74)	Predicted frameshift leading to PTC	Truncated protein has impaired nuclear localization and no DNA binding or transactivation activity	SOX2_00017	Exon	62	GGGCGG	-	G	CGGCGG	Duplication	NTD	Direct Sequencing	-	-	-
01	-	c.67_69dupGGC	-	p.(Gly33_Asn34insGly)	In-frame duplication of 3 bases	Insertion of Glycine in a run of Glycines	SOX2_00065	ORF exon	67	GGCGGC	-	GGC	AACTCC	Duplication	N-terminal domain	Direct Sequencing	-	-	-
01	-	c.67_89del23	-	p.(Gly23Argfs*65)	Frameshifting deletion predicted	Truncated protein predicted	SOX2_00007	Exon	67	GGCGGC	GGCAACTCCACCGCGGCGGCGGC	-	CGGCGG	Deletion	NTD	DHPLC	-	-	Deleted sequence is in triplet repeat region - replication slippage likely
01	-	c.70_86del17 (Reported 3 times)	-	p.(Asn24Glyfs*66)	Frame-shifting deletion predicted	PTC predicted	SOX2_00088	ORF exon	70	GGCGGC	AACTCCACCGCGGCGGC	-	GGCCGG	Deletion	N-terminal	Direct Sequencing	-	-	-
01	-	c.70_89del20 (Reported 15 times)	-	p.(Asn24Argfs*65)	Frameshifting deletion predicted	Frameshift PTC - truncated protein predicted	SOX2_00011	Exon	70	GGCGGC	AACTCCACCGCGGCGGCGGC	-	CGGCGG	Deletion	NTD	Direct Sequencing	-	-	Deleted sequence is in triplet repeat region - replication slippage likely
01	-	c.86_95dup10	-	p.(Asn33Glyfs*66)	Frame-shifting duplication predicted	PTC predicted	SOX2_00089	ORF exon	86	CGGCGG	CGGCCGGCGG	CGGCCGGCGGCGGCCGGCGG	CAACCA	Duplication	N-terminal	Direct Sequencing	-	-	-
01	-	c.131C>G	-	p.(Pro44Arg)	Pro (ccc) > Arg (cgc) predicted	HMG missense mutation predicted	SOX2_00066	ORF exon	131	AGCGGC	C	G	CATGAA	Substitution	HMG	Direct Sequencing	-	-	-
01	-	c.138T>G	-	p.(Asn46Lys)	Asn (aau) > Lys (aag) predicted	Predicted missense change in HMG box	SOX2_00012	Exon	138	CATGAA	T	G	GCCTTC	Substitution	HMG	DHPLC	StuI+	-	Mutation inherited from normal mother (presumed gonosomal mosaic)
01	-	c.138_140dupTGC	-	p.(Ala47dup)	In-frame insertion predicted	Duplication of Ala 47 predicted in HMG domain	SOX2_00075	ORF exon	138	CATGAA	TGC	TGCTGC	CTTCAT	Duplication	HMG	Direct Sequencing	-	-	-
01	-	c.143_144delTCinsAA	-	p.(Phe48*)	Phe (uuc) > Ter (uaa) predicted	Premature termination of translation predicted within HMG domain. Truncated protein has impaired nuclear localisation and transcriptional control activity.	SOX2_00071	ORF exon	143	ATGCCT	TC	AA	ATGGTG	Insertion/Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.151T>C	-	p.(Trp51Arg)	Trp (ugg) > Arg (cgg) predicted	Missense change affecting highly conserved residue in HMG box	SOX2_00090	ORF exon	151	ATGGTG	T	C	GGTCCC	Substitution	HMG	Direct Sequencing	-	-	-
01	-	c.158_174delinsATG	-	p.(Arg53Hisfs*37)	Frame-shifting indel predicted	PTC predicted	SOX2_00091	ORF exon	158	GGTCCC	GCGGGCAGCGGCGCAAG	ATG	ATGGCC	Insertion/Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.163C>T	-	p.(Gln55*)	Gln (cag) > Ter (uag) predicted	Nonsense PTC - truncated protein predicted	SOX2_00014	Exon	163	CGCGGG	C	T	AGCGGC	Substitution	HMG	DHPLC	-	-	-
01	-	c.181C>T	-	p.(Gln61*)	Nonsense mutation Gln (cag) > Ter (tag) predicted	Truncated protein does not bind DNA or repress beta-catenin-mediated trasncription	SOX2_00040	Exon	181	ATGGCC	C	T	AGGAGA	Substitution	HMG	Direct Sequencing	BfaI+	-	-
01	-	c.188delA	-	p.(Asn63Thrfs*40)	Predicted frameshift leading to PTC	Truncated protein predicted	SOX2_00028	Exon	188	AGGAGA	A	-	CCCCAA	Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.200delA	-	p.(His67Profs*36)	Frame-shifting deletion predicted	PTC predicted	SOX2_00092	ORF exon	200	AGATGC	A	-	CAACTC	Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.221G>C (Reported 2 times)	-	p.(Arg74Pro)	Arg (cgc) > Pro (ccc) predicted	Missense change in HMG domain predicted	SOX2_00015	Exon	221	GCAAGC	G	C	CCTGGG	Substitution	HMG	DHPLC	-	-	-
01	-	c.224T>A	-	p.(Leu75Gln)	Leu (cug) > Gln (cag) predicted	Missense protein has reduced DNA binding and transactivation activity	SOX2_00026	Exon	224	AGCGCC	T	A	GGGCGC	Substitution	HMG	Direct Sequencing	-	0/200	-
01	-	c.235C>T	-	p.(Trp79Arg)	ugg (Trp) > cgg (Arg) predicted	Missense change predicted. Mutant protein has reduced in vitro transactivating activity	SOX2_00103	ORF exon	235	GCCGAG	T	C	GGAAAC	Substitution	HMG	Direct Sequencing	-	-	-
01	-	c.236G>C	-	p.(Trp79Ser)	Trp (ugg) > Ser (ucg) predicted	Substitution of invariant Trp predicted	SOX2_00094	ORF exon	236	CCGAGT	G	C	GAAACT	Substitution	HMG	Direct Sequencing	-	-	-
01	-	c.244_245delTT (Reported 3 times)	-	p.(Leu82Valfs*13)	Frame-shifting deletion predicted	Truncated protein predicted	SOX2_00076	ORF exon	244	AAACTT	TT	-	GTCGGA	Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.245delT	-	p.(Leu82Cysfs*20)	Frame-shifting deletion predicted	PTC predicted	SOX2_00095	ORF exon	245	AACTTT	T	-	GTCGGA	Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.248C>A	-	p.(Ser83*)	Set (ucg) > Ter (uag) predicted	HMG nonsense mutation - truncated protein predicted	SOX2_00003	Exon	248	TTTTGT	C	A	GGAGAC	Substitution	HMG	DHPLC	-	-	-
01	-	c.255_256delGGinsT	-	p.(Glu86Argfs*17)	Frame-shifting indel predicted	PTC predicted	SOX2_00096	ORF exon	255	GGAGAC	GG	T	AGAAGC	Insertion/Deletion	HMG	Direct Sequencing	-	-	-
01	-	c.277G>T (Reported 3 times)	-	p.(Glu93*)	Glu (gag) > Ter (uag) predicted	HMG box nonsense mutation - truncated protein predicted	SOX2_00002	Exon	272	ATCGAC	G	T	AGGCTA	Substitution	HMG	DHPLC	MaeI+	-	-
01	-	c.285dupG	-	p.(Arg96Alafs*14)	Frameshifting insertion predicted	Frameshift creates PTC - truncated protein predicted	SOX2_00032	Exon	285	GCTAAG	-	G	CGGCTG	Duplication	HMG	Direct Sequencing	-	-	-
01	-	c.290T>C	-	p.(Leu97Pro)	Leu (cug) > Pro (ccg) missense change predicted	Predicted amino acid substitution in HMG box	SOX2_00008	Exon	290	AGCGGC	T	C	GCGAGC	Substitution	HMG	DHPLC	-	-	-
01	-	c.302A>G	-	p.(His101Arg)	Missense change His (cac) > Arg (cgc) predicted	Substitution of invariant amino acid in HMG domain predicted	SOX2_00077	ORF exon	302	CGCTGC	A	G	CATGAA	Substitution	HMG	Direct Sequencing	-	-	-
01	-	c.310G>T (Reported 2 times)	-	p.(Glu104*)	Glu (gag) > Ter (uag) predicted	Truncated protein predicted	SOX2_00048	ORF exon	310	ATGAAG	G	T	AGCACC	Substitution	CTD	Heteroduplex Analysis	-	0/80	-
01	-	c.329A>G	-	p.(Tyr110Cys)	Tyr (uac) > Cys (ugc) predicted	Missense mutation of invariant cysteine predicted. Mutatn protein has reduced DNA binding and transactivation activity	SOX2_00102	ORF exon	329	ATAAAT	A	G	CCGGCC	Substitution	-	Direct Sequencing	-	0/150	-
01	-	c.355C>T	-	p.(Pro112Leu)	Pro (ccc) > Leu (cuc)	Amino acid substitution predicted	SOX2_00122	ORF exon	335	ACCGGC	C	T	CCGGCG	Substitution	-	Other	-	-	Whole exome sequencing
01	-	c.368A>G (Reported 2 times)	-	p.(Asp123Gly)	Asp (gau) > Gly (ggu) predicted	Missense substitution of highly conserved aspartate residue predicted	SOX2_00056	ORF exon	368	AGAAGG	A	G	TAAGTA	Substitution	C-terminal domain	Direct Sequencing	-	-	-
01	-	c.387C>G	-	p.(=)	Gly (ggc) > Gly (ggg) predicted	No effect predicted	SOX2_00024	Exon	387	GCCCGG	C	G	GGGCTG	Substitution	CTD	Direct Sequencing	-	0/100	Variant inherited from unaffected father
01	-	c.387delC	-	p.(Leu131Cysfs*23	Predicted frameshift leading to PTC	Truncated protein has impaired transactivation activity	SOX2_00019	Exon	387	GCCCGG	C	-	GGCTGC	Deletion	CTD	Direct Sequencing	-	-	-
01	-	c.389G>C	-	p.(Gly130Ala)	Missense change Gly (ggg) > Ala (gcg) predicted	Nuclear localization, DNA binding and transactivation activity unaffected	SOX2_00023	Exon	389	CCGGCG	G	C	GCTGCT	Substitution	CTD	Direct Sequencing	BssHII+	0/100	Variant inherited from unaffected father
01	-	c.402delC	-	p.(Gly135Alafs*19)	Frame-shifting deletion predicted	Truncated protein predicted. Mutant protein has reduced in vitro transactivating activity	SOX2_00108	ORF exon	402	GGCCCC	C	-	GGCGGC	Deletion	CTD	Direct Sequencing	-	-	-
01	-	c.453G>A	-	p.(=)	Ala (gcg) > Ala (gca) predicted	No change expected	SOX2_00045	Exon	453	GGGCGC	G	A	GGCGTG	Substitution	CTD	Direct Sequencing	-	-	Presumed neutral variant
01	-	c.463C>T	-	p.(Gln155*)	Gln (cag) > Ter (uag) predicted	Nonsense PTC - truncated protein predicted	SOX2_00010	Exon	463	GTGAAC	C	T	AGCGCA	Substitution	CTD	SSCP	MaeI+	0/142	-
01	-	c.479delA	-	p.(Tyr160Serfs*4)	Frameshifting deletion predicted	Truncated protein has impaired transactivation activity	SOX2_00022	Exon	479	ACAGTT	A	-	CGCGCA	Deletion	CTD	Direct Sequencing	-	-	-
01	-	c.479dupA (Reported 2 times)	-	p.(Tyr160*)	Insertion creates immediate PTC	Truncated protein has impaired transactivation activity	SOX2_00020	Exon	479	CAGTTA	-	A	CGCGCA	Duplication	CTD	Direct Sequencing	HpaI+	-	-
01	-	c.479_480dupAC	-	p.(Ala161Thrfs*4)	Frame-shifting insertion predicted	Truncated protein predicted	SOX2_00079	ORF exon	479	ACAGTT	AC	ACAC	GCGCAC	Substitution	C-terminal	Direct Sequencing	-	-	-
01	-	c.480C>G (Reported 3 times)	-	p.(Tyr160*)	Tyr (uac) > Ter (uag) predicted	Nonsense PTC - truncated protein predicted	SOX2_00030	Exon	480	CAGTTA	C	G	GCGCAC	Substitution	CTD	Direct Sequencing	-	-	-
01	-	c.481G>T	-	p.(Ala161Ser)	Ala (gcg) > Ser (ucg) predicted	Missense change predicted (Ala is conserved at this position in all vertebrates)	SOX2_00115	ORF exon	481	AGTTAC	G	T	CGCACA	Substitution	-	Direct Sequencing	-	-	-
01	-	c.486_487dupCA	-	p.(Met163Thrfs*2)	Predicted frameshifting insertion, followed immediately by termination codon.	Termination of translation predicted	SOX2_00062	ORF exon	486	CGCGCA	-	CA	TGAACG	Duplication	C-terminal domain	Direct Sequencing	-	-	-
01	-	c.513C>G	-	p.(Tyr171*)	Nonsense mutation predicted	PTC predicted	SOX2_00099	ORF exon	513	CAGCTA	C	G	AGCATG	Substitution	CTD	Direct Sequencing	-	-	-
01	-	c.529C>T (Reported 3 times)	-	p.(Gln177*)	Gln (cag) > Ter (uag) predicted	Truncated protein predicted	SOX2_00004	Exon	529	CAGGAC	C	T	AGCTGG	Substitution	CTD	DHPLC	AvaI-, BfaI+	-	-
01	-	c.540C>G	-	p.(Tyr190*)	Nonsense mutation Tyr (uac) > Ter (uag) predicted	Truncated protein predicted	SOX2_00063	ORF exon	540	GGGCTA	C	G	CCGCAG	Substitution	C-terminal domain	Direct Sequencing	-	-	-
01	-	c.542delC	-	p(Pro181Argfs*22)	Frame-shifting deletion predicted	Truncated protein predicted	SOX2_00072	ORF exon	542	GCTACC	C	-	GCAGCA	Deletion	-	Direct Sequencing	-	-	-
01	-	c.551delC	-	p.(Pro184Argfs*19)	Frameshifting deletion leads to premature stop codon	Truncated protein predicted	SOX2_00049	ORF exon	551	AGCACC	C	-	GGGCCT	Deletion	CTD	Heteroduplex Analysis	-	0/80	Mutation inherted from normal mother
01	-	c.561T>C	-	p.(=)	Asn (aau) > Asn (aac) predicted	No effect predicted	SOX2_00044	Exon	561	CCTCAA	T	C	GCGCAC	Substitution	CTD	Direct Sequencing	-	-	Presumed neutral variant
01	-	c.571G>A	-	p.(Ala191Thr)	Missense change predicted: Ala (gca) > Thr (aca)	Nuclear localization, DNA binding and transactivation activity unaffected	SOX2_00025	Exon	571	CACGGC	G	A	CAGCGC	Substitution	CTD	Direct Sequencing	HhaI-	0/100	Variant inherited from unaffected father
01	-	c.599delA	-	p.(Tyr200Serfs*3)	Frame-shifting deletion predicted	PTC predicted	SOX2_00100	ORF exon	599	ACCGCT	A	-	CGACGT	Deletion	CTD	Direct Sequencing	-	-	-
01	-	c.628delA	-	p.(Met210*)	Frameshifting deletion creates immediate PTC	Truncated protein predicted	SOX2_00009	Exon	628	AACTCC	A	-	TGACCA	Deletion	CTD	DHPLC	NlaIII-	-	-
01	-	c.695C>A	-	p.(Thr232Asn)	Thr (acc) > Asn (aac) predicted	Missense change predicted	SOX2_00047	ORF exon	695	AGGGCA	C	A	CCCTGG	Substitution	CTD	Direct Sequencing	-	0/103	-
01	-	c.834C>T	-	p.(=)	Leu (cuc) > Leu (cuu) predicted	No change expected	SOX2_00046	Exon	834	GTATCT	C	T	CCCGGC	Substitution	NTD	Direct Sequencing	-	-	-
01	-	c.837delC	-	p.(Gly280Alafs*91)	Frame-shifting deletion predicted	Out-of-frame extension into 3'UTR predicted	SOX2_00070	ORF exon	837	TCTCCC	C	-	GGCGCC	Deletion	NTD	Direct Sequencing	-	-	-
01	-	c.841_651del11insA	-	p.(Ala281Argfs*87)	Frame-shifting deletion predicted	Translation into 3'UTR predicted	SOX2_00080	ORF exon	841	CCCGGC	GCCGAGGTGCC	A	GGAACC	Insertion/Deletion	C-terminal	Direct Sequencing	-	-	-
01	-	c.859G>C	-	p.(Ala287Pro)	Ala (gcc) > Pro (ccc) predicted	Missense change in C-terminal domain	SOX2_00067	ORF exon	859	GAACCC	G	C	CCGCCC	Substitution	C-terminal domain	Direct Sequencing	-	-	-
01	-	c.905delC	-	p.(Pro302Argfs*69)	Frame-shifting deletion predicted	Translation into 3'UTR predicted	SOX2_00101	ORF exon	905	GCGGCC	C	-	GGTGCC	Deletion	-	Direct Sequencing	-	0/6500	-
01	-	c.940delC	-	p.(Leu314Serfs*57)	Frame-shifting deletion at C-terminal end of ORF	Translational run-on into 3'UTR predicted	SOX2_00064	ORF exon	940	TGCCCC	C	-	TCTCAC	Deletion	C-terminal domain	Direct Sequencing	-	-	Deletion of a C from a run of C's - replication slippage likely
01	-	c.943_944delTC	-	p.(Ser315Thrfs*112)	Frameshifting deletion predicted	Translation into 3'UTR predicted	SOX2_00006	Exon	943	CCCCTC	TC	-	ACACAT	Deletion	CTD	DHPLC	-	-	Deletion of TC from TCTC motif
01	-	c.*22G>A (Reported 2 times)	-	-	Presumed neutral substitution at base 22 of 3'UTR	No effect predicted	SOX2_00042	3' UTR	976	CTGGAG	G	A	GGGGAG	Substitution	-	DHPLC	-	5/88	3'UTR polymorphism
01	-	c.*26dupG	-	p.(=)	Single nucleotide insertion in 3'UTR predicted	No effect predicted	SOX2_00116	3' UTR	-	GGGGGG	-	G	AGAAAT	Duplication	-	Direct Sequencing	-	-	-
01	-	c.*469C>A (Reported 2 times)	-	-	3'UTR change - no effect predicted	No effect predicted	SOX2_00051	3' UTR	1850	AAGCAA	C	A	TTTTGT	Substitution	3'UTR	Heteroduplex Analysis	-	-	Probable 3'UTR polymorphism
01	-	c.*557G>A	-	-	3'UTR change - no effect predicted based on current evidence	No effect predicted	SOX2_00050	3' UTR	1938	AGGAGA	G	A	GCTTCT	Substitution	3'UTR	Heteroduplex Analysis	-	0/80	Mutation unlikely to be causative based on current knowledge

1 - 78

Click here to save this list in a tab-delimited text file.

Legend: [ SOX2 full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Coding DNA Reference Sequence, with the first base of the Met-codon counted as position 1.
Exon: Exon number (always '01' for SOX2) Legacy DNA ID: This column is not used in the SOX2 database DNA change: Variation at DNA level (see full legend for details and examples). RNA change: Variation at RNA level (see Full Legend for examples) Protein change: Variation at protein level (see Full Legend for details and examples) RNA information: Additional information about RNA change Protein information: Additional information about protein change SOX2 DB-ID: Database IDentifier; unique identifier for each sequence variant Location: Variant location within the gene Base number: Position of change within cDNA 5' Sequence Context: Six bases immediately 5' of the change Original Sequence: The original (wild type) sequence Variant Sequence: The new (mutant or variant) sequence 3' Sequence Context: Six bases immediately 3' of the change Type: Type of variant at DNA level Domain: SOX2 protein domain: NTD (N-terminal domain), HMG (HMG box) or CTD (C-terminal domain) Detection Method: Technique used to detect the mutation RE Site: Variant creates (+) or destroys (-) a restriction enzyme recognition site Frequency: Frequency of polymorphism/variant Remarks: Any other comments

MRC Human Genetics Unit LOVD at MRC IGMM

SRY (sex determining region Y)-box 2 (SOX2)