LOVD - Variant listings for PAX6

Warning Please note that this overview may not be complete, as variants with unknown effect to the phenotype are left out.

About this overview [Show]

25 entries
entries per page


Exon Hide Exon column Descending
Ascending

Location Hide Location column Descending
Ascending

Legacy DNA ID Hide Legacy DNA ID column Descending
Ascending

DNA change   Descending
Ascending

RNA change Hide RNA change column Descending
Ascending

Protein change Hide Protein change column Descending
Ascending

RNA information Hide RNA information column Descending
Ascending

Protein information Hide Protein information column Descending
Ascending

DB-ID Hide DB-ID column Descending
Ascending

Base number Hide Base number column Descending
Ascending

5' Sequence Context Hide 5' Sequence Context column Descending
Ascending

Original Sequence Hide Original Sequence column Descending
Ascending

Variant Sequence Hide Variant Sequence column Descending
Ascending

3' Sequence Context Hide 3' Sequence Context column Descending
Ascending

Type Hide Type column Descending
Ascending

Domain Hide Domain column Descending
Ascending

Detection Method Hide Detection Method column Descending
Ascending

RE Site Hide RE Site column Descending
Ascending

Frequency Hide Frequency column Descending
Ascending

Remarks Hide Remarks column Descending
Ascending
02 Intron IVS2+9G>A c.-129+9G>A
  (Reported 2 times)
- - Intronic change does not affect any known splice signals - PAX6_00404 - GAGTCC G A CTTCTT - - Direct Sequencing - - -
04 Intron IVS4-85T>C c.11-85T>C - p.(=) No effect predicted No effect predicted PAX6_00575 11 TCATCT T C CCTCTT Substitution PD Direct Sequencing - 1/570 -
04 Intron IVS4-70_72delTCT c.11-70_72delTCT - p.(=) No effect predicted No effect predicted PAX6_00577 11 CCTTCT TCT - CCCTCT Deletion PD Direct Sequencing - 1/570 -
04 Intron IVS4-42C>T c.11-42C>T - p.(=) No effect prediced No effect predicted PAX6_00576 11 TGCTCT C T TTCTCT Substitution PD Direct Sequencing - 1/570 -
04 Intron IVS4-41T>C c.11-41T>C - p.(=) Substitution at intronic position -41 predicted; unlikely to affect splicing No change expected PAX6_00410 11 GCTCTC T C TCTCCT - - DHPLC - - -
05 Exon c.479G>A c.117G>A - p.(=) Neutral change Pro (ccg) > Pro (cca) predicted Neutral change in codon 39 PAX6_00567 117 CCGGCC G A TGCGAC Substitution PD Direct Sequencing - 1/570 -
05 Intron IVS5-163C>T (intron 5-1) c.142-163C>T - p.(=) No effect predicted No effect predicted PAX6_00578 143 TCATAC C T ATTGAA Substitution PD Direct Sequencing - 1/570 -
05 Intron IVS5-19G>C (intron 5-2) c.142-19G>C r.? - No predicted effect, but change appears to have occurred de novo in this affected individual Effect unknown PAX6_00345 142 TTCT G C TCCA - - SSCP - - Variant does not affect any known functional motif. However it does appear to have occurred de novo in the patient as the shifted SSCP band was absent in the unaffected parents
06 Exon - c.216T>G - p.(=) ggt (Gly) > ggg (Gly) predicted - PAX6_00635 216 AATCGG T G GGTAGT Substitution PD Direct Sequencing - - -
06 Exon c.681C>T c.319C>T - p.(=) Neutral change: Leu (cug) > Leu (uug) Neutral change in codon 107 PAX6_00568 319 AGATTA C T TGTCCG Substitution pd Direct Sequencing - 1/570 -
06 Intron IVS6+28C>T c.357+28C>T - p.(=) Predicted neutral intronic change No effect predicted PAX6_00572 357 GCCCTC C T CTGCCC Substitution PD Direct Sequencing - 1/570 -
07 Exon c.782C>T c.420C>T - p.(=) Asp (gac) > Asp (gau) predicted Predicted neutral substitution PAX6_00083 420 CGCAGA C T GGCATG Substitution LNK SSCP - - -
07 Intron IVS7-41T>G c.524-41T>G r.= p.(=) No change expected No change expected PAX6_00131 524 TCAAGT T G AATCCA Substitution - SSCP HinfI (+) - Mutation does not affect known splice signals - probably a polymorphism
08 Intron IVS8+14delT c.682+14delT - p.(=) No effect predicted No effect predicted PAX6_00579 682 AGTTTT T - CAAAGT Deletion - Direct Sequencing - 1/570 -
09 Intron IVS9-13A>T c.766-13A>T - p.(=) Probable intronic polymorphism No change expected PAX6_00081 766 TGTCCC A T CCTGAT Substitution - Chemical Cleavage of Mismatch - - -
09 Intron IVS9-12C>T c.766-12C>T
  (Reported 10 times)
- p.(=) Probably a neutral polymorphism No predicted effect on protein PAX6_00335 766 GTCCCA C T CTGATT - HD SSCP - - -
10 Exon c.1193G>A c.831G>A - p.(=) Predicted neutral substitution Gln (cag) > Gln (caa) No effect expected PAX6_00136 831 AAGACA G A GCCAGC Substitution PST Dideoxy Fingerprinting - - Patient has 2 variants - this one is likely to be silent
10 Exon c.1229T>C c.867T>C - p.(=) Neutral change predicted: Ser (agu) > Ser (agc) Neutral change in codon 289 PAX6_00569 867 CAGCAG T C AGTTTC Substitution PST Direct Sequencing - 4/570 -
10 Intron IVS10-22C>T c.917-22C>T - p.(=) Probably a neutral intronic change No change expected PAX6_00462 917 TGACTA C T TGTCAT - - DHPLC - - Patient also has c.1267dupT
12 Exon c.1522G>A c.1160G>A - p.(Gly387Asp) Gly (ggc) > Asp (gac) predicted PST missense change predicted PAX6_00214 1160 CAATGG G A CACCTC Substitution PST SSCP - - Variant inherited from normal father
12 Intron IVS12+11G>A c.1183+11G>A - p.(=) Predicted neutral intronic change No effect predicted PAX6_00573 1183 GCCACT G A CTTTCT Substitution PST Direct Sequencing - 1/570 -
12 Intron IVS12+43T>G c.1183+43T>G - p.(=) Neutral intronic change predicted No effect predicted PAX6_00574 1183 TCTCTC T G TCACTA Substitution PST Direct Sequencing - 261/570 -
13 Exon c.1556C>T c.1194C>T - p.(=) Neutral change predicted: Ser (ucc) > Ser (ucu) Neutral change in codon 398 PAX6_00570 1194 CATTTC C T CCTGGT Substitution PST Direct Sequencing - 4/570 -
13 3' UTR - c.*76G>A (NM_000280.4) - - - - PAX6_00702 - GTGACTATGGGGACACAACAGTTGA G A CTTTCAGGAAAGAAAGAAAAATGGC Substitution - - - - -
13 3' UTR - c.*2977C>A (NM_000280.4) - - - - PAX6_00703 - TGCAGGGATGTTTTGACACCATCTT C A CAGGATGGAGATTATTTGTGAAGAC Substitution - - - - -
1 - 25

Save Click here to save this list in a tab-delimited text file.

Legend: [ PAX6 full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Coding DNA Reference Sequence, with the first base of the Met-codon counted as position 1.
Exon: Exon numbering. Each number covers the exon and the following intron. Exon 5a is classified as part of exon 05. Location: Location of the genomic change. Legacy DNA ID: Legacy mutation nomenclature using the original PAX6 cDNA numbering. DNA change: Variation at DNA level (see full legend for details and examples). RNA change: Variation at RNA level (see full legend for details and examples). Protein change: Variation at protein level (see full legend for details and examples). RNA information: Additional information about RNA change. Protein information: Additional information about protein change. PAX6 DB-ID: DataBase IDentifier; unique identifier for each mutation. Base number: Position of change within cDNA. 5' Sequence Context: Bases immediately 5' of the sequence change. Original Sequence: The original (wild type) sequence. Variant Sequence: The new (mutant or variant) sequence. 3' Sequence Context: Bases immediately 3' of the sequence change. Type: Type of variant at DNA level. Domain: PAX6 protein domain. Detection Method: Technique used to detect the mutation. RE Site: Variant creates (+) or destroys (-) a restriction enzyme recognition site. Frequency: Frequency of polymorphism or variant. Remarks: Other information.