This database has been closed to new submissions.

The date of last curation was 07 June 2017 and the 'last update' on 04 August 2018 was a partial and uncurated update.

LOVD - Variant listings for PAX6

About this overview [Show]

Patient data (#0001737)
Patient ID -
Disease Aniridia
Reference/Submitter China:Luzhou
Template DNA
Technique PCR, SEQ
Remarks -
# Reported 1
Population Chinese
Gender male
Sequence Inheritance Familial
Phenotype Inheritance Familial
Second PCR -
CIS -
Conserved residue -
Related Phenotype -
Unrelated  Phenotype -
Submitter Bo Zeng

Variant data
Allele Maternal (inferred)
Reported pathogenicity Probably no pathogenicity
Concluded pathogenicity Unknown
Exon 13
Location 3' UTR
Legacy DNA ID -
DNA change c.*2977C>A (NM_000280.4)
RNA change -
Protein change -
RNA information -
Protein information -
DB-ID PAX6_00703
Base number -
5' Sequence Context TGCAGGGATGTTTTGACACCATCTT
Original Sequence C
Variant Sequence A
3' Sequence Context CAGGATGGAGATTATTTGTGAAGAC
Type Substitution
Domain -
Detection Method -
RE Site -
Frequency -
Remarks -

2 entries in PAX6

Path. Allele
Exon Descending
Ascending
Location Descending
Ascending
Legacy DNA ID Descending
Ascending
DNA change Descending
Ascending
RNA change Descending
Ascending
Protein change Descending
Ascending
RNA information Descending
Ascending
Protein information Descending
Ascending
DB-ID Descending
Ascending
Base number Descending
Ascending
5' Sequence Context Descending
Ascending
Original Sequence Descending
Ascending
Variant Sequence Descending
Ascending
3' Sequence Context Descending
Ascending
Type Descending
Ascending
Domain Descending
Ascending
Detection Method Descending
Ascending
RE Site Descending
Ascending
Frequency Descending
Ascending
Remarks Descending
Ascending
-?/? Maternal (inferred) 13 3' UTR - c.*76G>A (NM_000280.4) - - - - PAX6_00702 - GTGACTATGGGGACACAACAGTTGA G A CTTTCAGGAAAGAAAGAAAAATGGC Substitution - - - - -
-?/? Maternal (inferred) 13 3' UTR - c.*2977C>A (NM_000280.4) - - - - PAX6_00703 - TGCAGGGATGTTTTGACACCATCTT C A CAGGATGGAGATTATTTGTGAAGAC Substitution - - - - -