This database has been closed to new submissions.

The date of last curation was 07 June 2017 and the 'last update' on 04 August 2018 was a partial and uncurated update.

LOVD - Variant listings for PAX6

About this overview [Show]

Patient data (#0001993)
Patient ID -
Disease congenital aniridia
Reference/Submitter Russian Federation:Moscow
Template DNA
Technique SEQ
Remarks -
# Reported 1
Population -
Gender male
Sequence Inheritance -
Phenotype Inheritance -
Second PCR Yes
CIS No
Conserved residue -
Related Phenotype Congenital aniiridia, nystagmus, cataract, keratopathy, optic disc and fovea hypoplasia, epicanthus, ptosis
Unrelated  Phenotype -
Submitter Tatiana Vassilieva

Variant data
Allele Unknown
Reported pathogenicity Unknown
Concluded pathogenicity Unknown
Exon 05
Location Exon
Legacy DNA ID -
DNA change c.83_89delinsGA
RNA change -
Protein change p.(Lys28Argfs*26)
RNA information -
Protein information -
DB-ID PAX6_00933
Base number -
5' Sequence Context CCACTGCCGGACTCCACCCGGCAGA
Original Sequence AGATTGT
Variant Sequence GA
3' Sequence Context AGAGCTAGCTCACAGCGGGGCCCGG
Type Insertion/Deletion
Domain -
Detection Method Direct Sequencing
RE Site -
Frequency -
Remarks -

1 entry in PAX6

Path. Allele
Exon Descending
Ascending
Location Descending
Ascending
Legacy DNA ID Descending
Ascending
DNA change Descending
Ascending
RNA change Descending
Ascending
Protein change Descending
Ascending
RNA information Descending
Ascending
Protein information Descending
Ascending
DB-ID Descending
Ascending
Base number Descending
Ascending
5' Sequence Context Descending
Ascending
Original Sequence Descending
Ascending
Variant Sequence Descending
Ascending
3' Sequence Context Descending
Ascending
Type Descending
Ascending
Domain Descending
Ascending
Detection Method Descending
Ascending
RE Site Descending
Ascending
Frequency Descending
Ascending
Remarks Descending
Ascending
?/? Unknown 05 Exon - c.83_89delinsGA - p.(Lys28Argfs*26) - - PAX6_00933 - CCACTGCCGGACTCCACCCGGCAGA AGATTGT GA AGAGCTAGCTCACAGCGGGGCCCGG Insertion/Deletion - Direct Sequencing - - -