This database has been closed to new submissions.
The date of last curation was 07 June 2017 and the 'last update' on 04
August 2018 was a partial and uncurated update.

About this overview [Show] |
This detailed view shows all details of the selected patient, including all variants reported in this patient. At the bottom of the page, all variants reported in this patient are listed, with the one you are looking at in bold. The link to the UCSC Genome Browser will show the browser zoomed in to the location of the selected variant. |
Patient data (#0001993) |
Patient ID |
- |
Disease |
congenital aniridia |
Reference/Submitter |
Russian Federation:Moscow |
Template |
DNA |
Technique |
SEQ |
Remarks |
- |
# Reported |
1 |
Population |
- |
Gender |
male |
Sequence Inheritance |
- |
Phenotype Inheritance |
- |
Second PCR |
Yes |
CIS |
No |
Conserved residue |
- |
Related Phenotype |
Congenital aniiridia, nystagmus, cataract, keratopathy, optic disc and fovea hypoplasia, epicanthus, ptosis |
Unrelated Phenotype |
- |
Submitter |
Tatiana Vassilieva |
Variant data |
Allele |
Unknown |
Reported pathogenicity |
Unknown |
Concluded pathogenicity |
Unknown |
Exon |
05 |
Location |
Exon |
Legacy DNA ID |
- |
DNA change |
c.83_89delinsGA |
RNA change |
- |
Protein change |
p.(Lys28Argfs*26) |
RNA information |
- |
Protein information |
- |
DB-ID |
PAX6_00933 |
Base number |
- |
5' Sequence Context |
CCACTGCCGGACTCCACCCGGCAGA |
Original Sequence |
AGATTGT |
Variant Sequence |
GA |
3' Sequence Context |
AGAGCTAGCTCACAGCGGGGCCCGG |
Type |
Insertion/Deletion |
Domain |
- |
Detection Method |
Direct Sequencing |
RE Site |
- |
Frequency |
- |
Remarks |
- |
|