This database has been closed to new submissions.

The date of last curation was 07 June 2017 and the 'last update' on 04 August 2018 was a partial and uncurated update.

LOVD - Variant listings for PAX6

About this overview [Show]

879 public entries
entries per page

Path. Hide Path. column Descending

Exon Hide Exon column Descending

Location Hide Location column Descending

Legacy DNA ID Hide Legacy DNA ID column Descending

DNA change   Descending

RNA change Hide RNA change column Descending

Protein change Hide Protein change column Descending

RNA information Hide RNA information column Descending

Protein information Hide Protein information column Descending

DB-ID Hide DB-ID column Descending

Base number Hide Base number column Descending

5' Sequence Context Hide 5' Sequence Context column Descending

Original Sequence Hide Original Sequence column Descending

Variant Sequence Hide Variant Sequence column Descending

3' Sequence Context Hide 3' Sequence Context column Descending

Type Hide Type column Descending

Domain Hide Domain column Descending

Detection Method Hide Detection Method column Descending

RE Site Hide RE Site column Descending

Frequency Hide Frequency column Descending

Remarks Hide Remarks column Descending

Patient ID Hide Patient ID column Descending

Disease Hide Disease column Descending

Reference/Submitter Hide Reference/Submitter column Descending

Template Hide Template column Descending

Technique Hide Technique column Descending

Remarks Hide Remarks column Descending

# Reported Hide # Reported column Descending

Population Hide Population column Descending

Gender Hide Gender column Descending

Sequence Inheritance Hide Sequence Inheritance column Descending

Phenotype Inheritance Hide Phenotype Inheritance column Descending

Second PCR Hide Second PCR column Descending

CIS Hide CIS column Descending

Conserved residue Hide Conserved residue column Descending

Related Phenotype Hide Related Phenotype column Descending

Unrelated  Phenotype Hide Unrelated  Phenotype column Descending
+/+ - Whole gene PAX6 deletion chr11:18,536,224-31,923,308 r.0 p.0 All exons missing - no transcription - PAX6_00888 - - - - - Deletion - CGH - - Whole gene deletion (13.9 Mb), also detected by MLPA Blanco-Kelly 2017 Aniridia Blanco-Kelly et al 2017 [28231309], Spain:Madrid DNA CGH Whole gene deletion (13.9 Mb), also detected by MLPA 1 Spanish female de novo Sporadic - - - Syndromic aniridia -
+/+ - Whole gene PAX6 deletion chr11:21,254,000-32,564,000del r.0 p.0 All exons missing - no transcription - PAX6_00869 - - - - - Deletion - CGH - - Whole gene deletion also detected by FISH 1851 Aniridia [27124303], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - - - - - - - - -
+/+ - Whole gene PAX6 deletion chr11:21,586,131-33,168,232 r.0 p.0 All exons missing - no transcription - PAX6_00890 - - - - - Deletion - CGH - - Whole gene deletion (11.6 Mb), also detected by STR analysis Blanco-Kelly 2017 Aniridia Blanco-Kelly et al 2017 [28231309], Spain:Madrid DNA CGH Whole gene deletion (11.6 Mb), also detected by STR analysis 1 Spanish male de novo Sporadic - - - Aniridia and developmental delay. No Wilms tumour -
+/+ - Whole gene PAX6 deletion chr11:29,750,813-32,752,091 r.0 p.0 All exons missing - no transcription - PAX6_00884 - - - - - Deletion - CGH - - Whole gene deletion (3Mb) also validated by MLPA Blanco-Kelly 2017 Aniridia Blanco-Kelly et al 2017 [28231309], Spain:Madrid DNA CGH Whole gene deletion (3Mb) also detected by MLPA 1 Spanish female de novo Sporadic - - - WAGR syndrome -
+/+ - Whole gene PAX6 deletion chr11:31,199,000-31,849,000del r.0 p.0 All exons missing - no transcription - PAX6_00870 - - - - - Deletion - CGH - - Whole gene deletion (650kb) also detected by FISH 2193 Aniridia [27124303], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - Familial - - - Aniridia -
+/+ - Whole gene PAX6 deletion chr11:31,394,000-31,914,000del r.0 p.0 All exons missing - no transcription - PAX6_00871 - - - - - Deletion - CGH - - Whole gene deletion 520kb 377 Aniridia [27124303], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - - - - - - -
+/+ - Whole gene PAX6 deletion chr11:31,698,271-31,794,414del r.0 p.0 All exons missing - no transcription - PAX6_00873 - - - - - Deletion - CGH - - Whole gene deletion (96kb) 1977 Aniridia [27124303], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - Familial - - - Bilateral aniridia, cataract -
+/+ - Whole gene PAX6 deletion chr11:31,779,000-31,933,000del r.0 p.0 All exons missing - no transcription - PAX6_00872 - - - - - Deletion - CGH - - Whole gene deletion 154kb 1510 Aniridia [27124303], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - - - - - - -
+/+ - Whole gene PAX6 deletion del(11)(p12p14.2) r.0 p.0 All exons missing - no transcription - PAX6_00867 - - - - - Deletion - Other - - Whole gene deletion detected by cytogenetic analysis Patient 25 Aniridia [27081561], United Kingdom (Great Britain):Edinburgh DNA Other Deletion detected by cytogenetic analysis 1 - female - Sporadic - - - Total aniridia, cataract, foveal hypoplasia. No mental retardation. No Wilms’ tumour -
+/+ - Whole gene PAX6 deletion del(11)(p13p14) r.0 p.0 All exons missing - no transcription - PAX6_00868 - - - - - Deletion - Other - - Whole gene deletion detected by cytogenetic analysis Patient 26 Aniridia [27081561], United Kingdom (Great Britain):Edinburgh DNA Other Deletion detected by cytogenetic analysis 1 - male - Sporadic - - - Total aniridia, cataract, foveal hypoplasia. No mental retardation. No Wilms’ tumour -
+/+ - - - Deletion of exons 5 and 6 - - - - PAX6_00842 - - - - - Deletion - CGH - - - 1002 Aniridia [26661695], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - Sporadic - - - - -
+/+ - - - Deletion P1 promoter to exon 4 - - - - PAX6_00841 - - - - - Deletion - CGH - - - 228 Aniridia [26661695], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - male - Sporadic - - - - -
+/+ 1-5 - - chr11:31,780,904_31,789,463del - - Exons 1-5 missing - PAX6_00708 - - - - - Deletion - MLPA - - 8.5 kb deletion of exons 1-5 - Congenital aniridia Russian Federation:Moscow DNA MLPA - 1 Crimea Tatar female de novo Sporadic - no - OU partial aniridia, microcornea, macular hypoplasia, normal lens -
?/? 02 Exon c.225del13 -138_-129+3del13 r.spl? p.? Exon/intron junction deleted - probable splice error Outcome unknown without RNA analysis PAX6_00502 1 AGGATG CCTCATAAAG/GTG - AGTCCG Deletion - DHPLC - - - 284 Aniridia [18241071], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - - - Sporadic Y - - - -
?/? 02 Intron IVS2+2T>A c.-129+2T>A r.spl? - Predicted abolition of intron 2 splice donor. Outcome unknown Effect on protein unknown PAX6_00400 - TAAAG/G T A GAGTCC - - DHPLC - - - n/a Atypical Gillespie Syndrome [17148041], United Kingdom (Great Britain):Edinburgh DNA DHPLC Gillespie syndrome is characterised by iris hypoplasia ('partial aniridia'), cerebellar ataxia and mental retardation. This patient does not have ataxia and may therefore have a variant PAX6 phenotype. It is unclear if the mild neurological anomalies are associated with the PAX6 mutation or not 1 - Male Sporadic Sporadic - - Yes 'Atypical Gillespie syndrome': ptosis, iris anomalies, foveal hypoplasia, retinal vascular tortuosity -
+/- 02 Intron IVS2+9G>A c.-129+9G>A - - Intronic change does not affect any known splice signals - PAX6_00404 - GAGTCC G A CTTCTT - - Direct Sequencing - - - Case D Microphthalmia, Nystagmus, Cataract [17417613], United Kingdom (Great Britain):Edinburgh DNA Direct Sequencing There is no evidence that this change has a functional effect on RNA processing or that it has arisen de novo in this individual. Therefore it is best considered a polymorphism at present. 1 - - - Sporadic - No No Microcornea, partial sclerocornea + band shaped keratitis in left eye. Normal brain CT scan -
-/- 02 Intron IVS2+9G>A c.-129+9G>A
    + c.357+1G>C
- - Intronic change does not affect any known splice signals - PAX6_00541 - GAGTCC G A CTTCTT - - Direct Sequencing - - Normal father has same variant Case 18 Aniridia [18776953], United Kingdom (Great Britain):Edinburgh DNA SEQ Intron 6 mutation absent from both parents. Intron 2 variant present in normal father. 1 Mexican female Sporadic Sporadic - - - Subtotal aniridia, nystagmus, macular hypoplasia, ectopia lentis, microcornea, optic nerve hypoplasia -
?/? 02 Intron IVS2-2delA c.-128-2delA r.spl? - Probable splice error Effect on translation unknown PAX6_00168 1 TCTT A - G/GGGGA Deletion - Unknown DdeI (-) - - 294-97 Aniridia G Wildhart, unpublished, Germany:Mainz DNA Unknown - 1 - Female - - Unknown Unknown n/a - -
?/? 02 Intron IVS2-2delA c.-128-2delA r.spl? - Splice error predicted Effect on translation unknown PAX6_00077 1 TGTCTT A - G/GGGGA Deletion - Heteroduplex Analysis DdeI (-) - Mutation segregates with phenotype but effect is unknown RIBMAR Aniridia [9281415], United Kingdom (Great Britain):Edinburgh DNA Heteroduplex Analysis Mutation destroys DdeI site 1 - Male Familial Familial Yes Unknown n/a Same mutation in affected sister and niece; absent in normal brother and mother -
?/? 02 Intron IVS2-2delA c.-128-2delA r.spl? p.? Probable splice error Effect on translation unknown PAX6_00499 1 TCTT A - G/GGGGA Deletion - DHPLC DdeI (-) - - 190 Aniridia [18241071], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - - - Sporadic Y - - - -
+?/? 02 Intron IVS2-2delA c.-128-2delA r.spl? - Probable splice error Effect on translation unknown PAX6_00750 - TGTCTT A - G/GGGGA Deletion - Direct Sequencing - - - 26.03 Aniridia [28321846], Russian Federation:Moscow DNA SEQ - 1 - male de novo Sporadic - - - OU: Aniridia complete, nystagmus, clear lens. rnMuscular dystonia. -
+/+ 03 Intron IVS2-1G>T c.-128-1G>T r.spl? p.? Probable splice error Effect unknown PAX6_00680 1 GTCTTA G T /GGGGAA Substitution 5'UTR Direct Sequencing - - - Patient 2 Skeens 2011 Variant Aniridia [21376398] , United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - - - Familial - - - Keratopathy, limbal stem cell deficiency, abnormal corneal epithelium, iris hypoplasia -
?/? 03 5' UTR - c.-118_-117delTT - p.? - - PAX6_00931 - - - - - Deletion - Direct Sequencing - - - - congenital aniridia Russian Federation:Moscow DNA SEQ - 1 Jewish male de novo Sporadic Yes No - Congenital aniridia, nystagmus, cataract, partial optic atrophy, fovea hypoplasia -
?/? 03 Exon c.246del4 c.-116_-112delTAAC - - Effect unknown Effect unknown PAX6_00146 - AGACTT TAAC - TAGGGG Deletion - Dideoxy Fingerprinting - - Deleted sequence was originally submitted as TGAC - presumed to be a typo, since actual sequence at this position is TAAC 31 (29795) Aniridia, Nystagmus [10234503], Denmark:Glostrup DNA Dideoxy Fingerprinting - 1 - Male - - Unknown Unknown n/a Mild nystagmus; lens ectopia -
?/? 03 Intron IVS3+1delG c.-52+1delG r.spl? - Predicted 5'UTR splice error - outcome unknown Outcome unknown PAX6_00006 - TTTCAG/ G - CAAGTT Deletion - SSCP - - - Ch Aniridia [1345175], United Kingdom (Great Britain):Edinburgh DNA SSCP - 1 - Unknown - - Unknown No n/a Familial aniridia -
+/+ 03 Intron IVS3+1G>A c.-52+1G>A r.-128_142-95del p.? Skipping of exons 3, 4, 5 & 5a confirmed by RT-PCR Effect on protein unknown PAX6_00143 1 TTTCAG/ G A CAAGTT Substitution - Dideoxy Fingerprinting, RT-PCR - - - 18 (18999) Aniridia, Cataract, Glaucoma, Nystagmus [10234503], Denmark:Glostrup DNA RT-PCR, Dideoxy Fingerprinting - 1 - Male - - Unknown Unknown n/a Familial case: mild nystagmus, early cataract, mild corneal dystrophy, glaucoma -
+/+ 03 Intron IVS3+1G>A c.-52+1G>A r.spl? p.? Exon skipping likely by analogy with PAX6_00143 Effect on protein unknown PAX6_00503 1 TTTCAG/ G A CAAGTT Substitution - Direct Sequencing - - - Patient 1 Aniridia [18483559], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - - - - - - - Isolated aniridia -
+/+ 03 Intron IVS3+1G>A c.-52+1G>A r.-128_142-95del p.? Exon skipping predicted by analogy with PAX6_00143 Effect on protein unknown PAX6_00504 1 TTTCAG/ G A CAAGTT Substitution - Direct Sequencing - - - Patient 53 Aniridia [18483559], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - - - - - - - Isolated aniridia -
+/+ 03 Intron IVS3+5G>C c.-52+5G>C r.spl? p.? Splice defect predicted Effect on protein unknown PAX6_00505 1 AG/GCAA G C TTCTGT Substitution - Direct Sequencing - - - Patient 21 Aniridia [18483559], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - - - - - - - Isolated aniridia -
+/+ 3-7 Exon - chr11:31,778,912_31,794,631del c.(?_-127)_523+?del - Deletion of exons 3-7. Abnormal splicing predicted. - PAX6_00780 - - - - - Deletion - MLPA - - vassilievat - Congenital aniridia Russian Federation:Moscow DNA MLPA - 1 Karachay male de novo Sporadic - - - OU complete aniridia, congenital cataract, glaucoma, microcornea Chest deformation
+/+ 3- - - 03_13del - - Deletion of exons 3-13 - effect on RNA unknown - PAX6_00837 - - - - - Deletion - MLPA - - - Case 4 BG Aniridia [26849621], United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - female - - - - - Complete bilateral aniridia, nystagmus, cataracts -
+/+ 04 Exon - c.1A>C - p.(Met1?) Initiation codon abolished: Met (atg) > Leu (ctg) Possible failure of translation or initiation from cryptic start sites PAX6_00776 1 CCAGC A C TGCAG Substitution - Direct Sequencing - - - A-37 Congenital aniridia [28321846], Russian Federation:Moscow DNA SEQ - 1 Russian female de novo Sporadic yes no yes OU: complete aniridia, disc hypoplasia, nystagmus, microcornea Right kidney doubling
+/+ 04 Exon c.363A>G c.1A>G - p.(Met1?) Initiation codon abolished: Met (aug) > Val (gug) Possible failure of translation or initiation from cryptic start sites PAX6_00167 1 GCCAGC A G TGCAGA Substitution - Unknown SphI (-) - - 293-96 Aniridia G Wildhart, unpublished, Germany:Mainz DNA Unknown - 1 - Male - Sporadic Unknown Unknown Yes - -
+/+ 04 Exon c.363A>G c.1A>G - p.(Met1?) Initiation codon abolished: Met (aug) > Val (gug) Possible failure of translation or initiation from cryptic start sites PAX6_00627 1 GCCAGC A G TGCAGA Substitution - Direct Sequencing SphI (-) - - QT522 Aniridia [21850189], United Kingdom (Great Britain):Edinburgh DNA SEQ Mother with same mutation has coloboma-like iris defects 2 Chinese female Familial Familial - - - - Nystagmus, foveal hypoplasia, aniridia, punctate cataract
+/+ 04 Exon c.363A>G c.1A>G - p.(Met1?) Initiation codon abolished: Met (aug) > Val (gug) Possible failure of translation or initiation from cryptic start sites PAX6_00778 1 GCCAGC A G TGCAGA Substitution - Direct Sequencing - - - 51AN Congenital aniridia [28321846], Russian Federation:Moscow DNA SEQ - 1 Bulgarian male - Sporadic - - yes OU: partial aniridia, cataract, nystagmus, macular and optic nerve hypoplasia, keratopathy, corpus callosum hypoplasia asthma, pulmonary artery stenosis, maxillary sinus hypoplasia
+/+ 04 Exon c.363AT>CA c.1_2delATinsCA - p.(Met1?) Initiation codon abolished: Met (aug) > Gln (cag) Possible failure of translation or initiation from cryptic start sites PAX6_00125 1 GCCAGC AT CA GCAGAA Insertion/Deletion - SSCP SphI (-) - - SPAN18 Aniridia, Nystagmus [9727514], United Kingdom (Great Britain):Edinburgh DNA SSCP - 1 - Female - Sporadic Unknown Unknown n/a Nystagmus, keratopathy, glaucoma, macular hypoplasia, abnormal ERG (rod and cone) -
+/+ 04 Exon c.364T>A c.2T>A - p.(Met1?) Initiation codon abolished: Met (aug) > Lys (aag) Possible failure of translation or initiation from cryptic sites PAX6_00148 2 CCAGCA T A GCAGAA Substitution - Dideoxy Fingerprinting SphI (-) - - 16 (19714) Aniridia, Cataract, Glaucoma, Nystagmus [10234503], Denmark:Glostrup DNA Dideoxy Fingerprinting - 1 - Female - Familial Yes Unknown Yes Intermediate nystagmus, lens ectopia, late cataract, mild corneal dystrophy, moderate photophobia, glaucoma -
+/+ 04 Exon c.364T>A c.2T>A - p.(Met1?) Initiation codon abolished: Met (aug) > Lys (aag) Possible failure of translation or initiation from cryptic sites PAX6_00846 2 CCAGCA T A GCAGAA Substitution - Direct Sequencing - - - Proband I:1 Aniridia [26535646], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation present in 8 affected members but not in 4 unaffected members of a 3-generation family 1 Chinese female Familial - - - - All affected members have aniridia, nystagmus and ptosis -
+/+ 04 Exon c.364T>G c.2T>G - p.(Met1?) Initiation codon abolished: Met (aug) > Arg (agg) Possible failure of translation or initation from cryptic sites PAX6_00407 2 CCAGCA T G GCAGAA Substitution - DHPLC SphI (-) - - PY2K/368 Partial Aniridia [16712695], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Female - Familial Yes - Yes Bilateral partial aniridia. Father also affected. -
+/+ 04 Exon c.364T>G c.2T>G - p.(Met1?) Initiation codon abolished: Met (aug) > Arg (agg) Possible failure of translation or initation from cryptic sites PAX6_00408 2 CCAGCA T G GCAGAA Substitution - DHPLC SphI (-) - - D2006/65 Aniridia K Williamson & V van Heyningen, unpublished, United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Female - - Yes - Yes - -
+/+ 04 Exon c.365delG c.3delG - p.(Met1?) Start codon destroyed by frame-shifting deletion Possible failure of translation or initation from cryptic sites PAX6_00409 3 CAGCAT G - CAGAAC Deletion - DHPLC SphI (-) - - D2003/85 Aniridia [16712695], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Female Familial Familial Yes - Yes Same mutation in similarly affected father and son -
+/+ 04 Exon c.366delC c.4delC - p.(Gln2Argfs*7) Frameshift predicted, leading to PTC NMD predicted - protein synthesis unlikely PAX6_00471 4 AGCATG C - AGAACA Substitution - DHPLC - - - 133 Aniridia [18241071], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - - - Familial Y - - - -
+/+ 04 Exon - c.7_10dupAACA - p.(Ser4Lysfs*53) Frame-shifting duplication leading to PTC. NMD likely Protein synthesis unlikely PAX6_00761 7 AGAACA - AACA /GTAAGT Duplication PD Direct Sequencing - - Not found in 150 controls AN-18-1 Aniridia [25678763], United Kingdom (Great Britain):Edinburgh DNA SEQ Father (AN-118-2) with same mutation has partial aniridia, nystagmus, foveal hypoplasia, cataract, glaucoma. Mutation absent from unaffected mother 1 Southern India male Familial Familial - - - Aniridia, nystagmus, foveal hypoplasia, microcornea -
+/+ 04 Intron IVS4+1G>A c.10+1G>A r.spl? - Splice error highly likely - PAX6_00762 10 ACAACA/ G A TAAGTG Substitution PD Direct Sequencing - - Not found in 150 controls AN-99-1 Aniridia [25678763], United Kingdom (Great Britain):Edinburgh DNA SEQ Father (AN-99-2) with same mutation has aniridia, keratopathy, nystagmus, foveal hypoplasia, cataract, glaucoma. Mutation absent from unaffected mother 1 Southern India male Familial Familial - - - Aniridia, nystagmus, foveal hypoplasia -
+/+ 04 Intron IVS4+3AA>GC c.10+3_+4delAAinsGC r.-51_10del p.? Skipping of exon 4 confirmed by RT-PCR Possible failure of translation or initiation from cryptic start sites PAX6_00051 10 AACA/GT AA GC GTG Insertion/Deletion - SSCP, RT-PCR, Chemical Cleavage of Mismatch - - - p236113 Aniridia [9138149], United Kingdom (Great Britain):Edinburgh DNA RT-PCR, SSCP, Chemical Cleavage of Mismatch - 1 - Female - Familial Yes No Splice donor - -
+/+ 04 Intron IVS4+5G>C c.10+5G>C r.-51_10del p.? Skipping of exon 4 confirmed by RT-PCR Possible failure of translation or initiation from cryptic start sites PAX6_00383 10 CA/GTAA G C TGCCTC - PD SSCP, RT-PCR - - - 1 Nystagmus, Iris Hypoplasia, Foveal Hypoplasia [15629294], United Kingdom (Great Britain):Edinburgh DNA RT-PCR, SSCP Authors suggest possible use of alternative initiation codon in exon 3. Erroneously entered in old database as IVS+4G>C 1 - Female Familial Familial - No - Affected mother and two maternal aunts have variable iris defects with foveal hypoplasia and nystagmus -
+/+ 04 Intron IVS4+5G>C c.10+5G>C r.spl? p.? Probable splice error Skipping of exon 4 likely by analogy with PAX6_00383 PAX6_00298 10 CA/GTAA G C TGCCTC - - SSCP, DGGE - - - 00/1087 Iris Hypoplasia, Nystagmus, Foveal Hypoplasia [12634864], United Kingdom (Great Britain):Edinburgh DNA DGGE, SSCP - 1 - Unknown - Familial Unknown No - Atypical coloboma -
-/- 04 Intron IVS4-85T>C c.11-85T>C - p.(=) No effect predicted No effect predicted PAX6_00575 11 TCATCT T C CCTCTT Substitution PD Direct Sequencing - 1/570 - Maekawa et al Autism [19607881], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 285 autistic Japanese subjects - - - - - - - -
-/- 04 Intron IVS4-70_72delTCT c.11-70_72delTCT - p.(=) No effect predicted No effect predicted PAX6_00577 11 CCTTCT TCT - CCCTCT Deletion PD Direct Sequencing - 1/570 - Maekawa et al Autism [19607881], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 285 autistic Japanese subjects - - - - - - - -
-/- 04 Intron IVS4-42C>T c.11-42C>T - p.(=) No effect prediced No effect predicted PAX6_00576 11 TGCTCT C T TTCTCT Substitution PD Direct Sequencing - 1/570 - Maekawa et al Autism [19607881], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 285 autistic Japanese subjects - - - - - - - -
-/- 04 Intron IVS4-41T>C c.11-41T>C - p.(=) Substitution at intronic position -41 predicted; unlikely to affect splicing No change expected PAX6_00410 11 GCTCTC T C TCTCCT - - DHPLC - - - D2001/78 Peters anomaly K Williamson & V van Heyningen, unpublished, United Kingdom (Great Britain):Edinburgh DNA DHPLC Substitution at position -41 of intron 4 is probably a neutral polymorphism 1 - - - - Yes - No Bilateral Peters anomaly Tetralogy of Fallot; Hirschprung Disease
+/+ 04 Intron IVS4-2A>G c.11-2A>G r.spl? p.? Splice error predicted Protein outcome unclear without RNA analysis PAX6_00067 11 TTCCTC A G G/GTCAC Substitution PD SSCP AvaI (+) - - DEDOW Aniridia [10857836], United Kingdom (Great Britain):Edinburgh DNA SSCP - 1 - Male - Familial Yes Unknown n/a - -
+/+ 04 Intron IVS4-2A>G c.11-2A>G r.spl? p.? Splice defect highly likely Effect on protein unknown PAX6_00637 11 TTCCTC A G GGTCAC Substitution PD Direct Sequencing - - - Case 1-2 Aniridia [22393275], United Kingdom (Great Britain):Edinburgh DNA SEQ Mother with same mutation has aniridia, nystagmus, cataract and macular hypoplasia 2 Korean female Familial Familial - - - Aniridia, nystagmus, keratopathy, corneal opacity -
+/+ 04 Intron IVS4-2A>G c.11-2A>G r.spl? p.? Splice error predicted Protein outcome unclear without RNA analysis PAX6_00671 11 TTCCTC A G G/GTCAC Substitution PD Direct Sequencing - - Variant absent from 100 controls P2 Aniridia [21904390], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Chinese - - Sporadic - - - Bilateral complete aniridia, congenital cataract, nystagmus -
+/+ 05 Exon - chr11:31,760,458-31,823,847 - - Deletion of exons 5a to 13. Effect on RNA unknown - PAX6_00887 - - - - - Deletion - CGH - - Deletion of 63 Kb of exons 5a to 13 of PAX6 and ELP4, also detected by MLPA in the affected mother Blanco-Kelly 2017 Aniridia Blanco-Kelly et al 2017 [28231309], Spain:Madrid DNA CGH Deletion of 63 Kb of exons 5a to 13 of PAX6 and ELP4, also detected by MLPA in the affected mother 1 Spanish male Maternal Familial - - - Isolated aniridia -
+?/? 05 Exon - c.19G>C - p.(Gly7Arg) - - PAX6_00732 19 CACAGC G C GAGTGA Substitution - Direct Sequencing - - vassilievat 11.21 Aniridia [28321846], Russian Federation:Moscow DNA SEQ Mother with same mutation has partial aniridia 1 - female - Familial - - - Aniridia complete, nystagmus, keratopathy grade I, lens subluxation Residual encephalopathy, mild hypotonic syndrome, talipes valgus, right palm chondroma
+/+ 05 Exon c.381G>T c.19G>T - p.(Gly7*) Gly (gga) >Ter (tga) predicted NMD predicted - protein synthesis unlikely PAX6_00472 19 CACAGC G T GAGTGA Substitution PD DHPLC - - - 130 Aniridia [18241071] , United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - - - Sporadic Y - - - -
+/+ 05 Exon c.381G>T c.19G>T - p.(Gly7*) Gly (gga) >Ter (tga) predicted NMD predicted - protein synthesis unlikely PAX6_00638 19 CACAGC G T GAGTGA Substitution PD Direct Sequencing - - - Case 2 Aniridia [22393275], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Korean male - Sporadic - - - Aniridia, nystagmus, keratopathy, cataract -
+/+ 05 Exon c.388A>T c.26A>T - p.(Asn9Ile) Asn (aau) > Ile (auu) predicted Predicted missense mutation. Asn9 is conserved in all paired domains PAX6_00411 26 GAGTGA A T TCAGCT Substitution PD DHPLC - - - D2002/53 Nystagmus, Ectopia Pupillae [16712695], United Kingdom (Great Britain):Edinburgh DNA DHPLC In the genomic sequence trace (from blood DNA) the mutant allele was present at approximately 10%. Therefore this individual may be a somatic mosaic for the mutation 1 - Female - - Yes - Yes Variant aniridia: nystagmus with nasally displaced pupils -
+/+ 05 Exon c.389_393dupTCAGC c.27_31dupTCAGC - p.(Gly12Serfs*21) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00398 27 ATCAGC - TCAGC TCGGTG Duplication PD SSCP - - - ANF8-1 Aniridia, Cataract, Foveal Hypoplasia, Nystagmus [16803629], United Kingdom (Great Britain):Edinburgh DNA SSCP - 1 - Male Familial Familial - - n/a Bilateral keratopathy. Affected relatives have same mutation -
?/? 05 Exon c.390C>T c.28C>T - p.(Gln10*) Early nonsense mutation - NMD of RNA predicted Protein synthesis unlikely - NMD of RNA predicted PAX6_00412 28 GTGAAT C T AGCTCG Substitution PD DHPLC - - - PY2K/356 Aniridia [16712695], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Female - - Yes - n/a Possible familial mutation - half brother has bilateral iris anomaly and cataracts. Common father is normal - possible gonadal mosaic -
+/+ 05 Exon c.390C>T c.28C>T - p.(Gln10*) Early nonsense mutation - NMD of RNA predicted Protein synthesis unlikely - NMD of RNA predicted PAX6_00781 28 GTGAAT C T AGCTCG Substitution PD Direct Sequencing - - - 157 Anridia [26661695], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female - Sporadic - - - Classical aniridia -
?/? 05 Exon c.395delC c.33delC - p.(Gly12Valfs*19) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00100 33 TCAGCT C - GGTGGT Deletion PD SSCP - - - 187HD Aniridia [9792406], Germany:Mainz DNA SSCP - 1 - Female - Familial Unknown No n/a - -
+/+ 05 Exon c.396G>C c.34G>C - p.(Gly12Arg) Gly (ggt) > Arg (cgt) predicted Missense change predicted PAX6_00509 34 CAGCTC G C GTGGTG Substitution PD Direct Sequencing - - - Patient 19 Aniridia [18483559], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - - - - - - - Isolated aniridia -
?/? 05 Exon c.402del2 c.40_41delGT - p.(Val14Leufs*41) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00355 40 GGTGGT GT - CTTTGT Deletion PD Direct Sequencing - - - c.402del2 Aniridia, Diabetes mellitus Nishi M et al 2004 Diabetic Medicine 22 641-644, Japan:Wakayama DNA Direct Sequencing - 1 - Female - Sporadic Unknown Unknown Unknown Aniridia, strabismus. Normal olfaction, normal brain MRI scan Early-onset diabetes mellitus; may be associated with PAX6 mutation since PAX6 is expressed in the endocrine pancreas
+/+ 05 Exon c.406_407delTT c.44_45delTT - p.(Phe15Argfs*40) PTC predicted - NMD of RNA likely Protein synthesis unlikely PAX6_00397 44 GTGTCT TT - GTCAAC Deletion PD SSCP - - - ANF9-1 Aniridia, Foveal Hypoplasia, Nystagmus [16803629], United Kingdom (Great Britain):Edinburgh DNA SSCP - 1 - Female - Familial - - n/a Father also affected -
?/? 05 Exon c.412A>G c.50A>G
    + c.85A>G, c.141+14_+25dup12
- p.(Asn17Ser) Asn (aac) > Ser (agc) predicted Predicted missense mutation PAX6_00192 50 TTGTCA A G CGGGCG Substitution PD SSCP - - Patient has 2 other PAX6 variants, c.85A>G and c.141+14_+25dup12 Patient 1 Foveal Hypoplasia, Aniridia, Cataract, Nystagmus [9856761], United Kingdom (Great Britain):Edinburgh DNA SSCP Patient has 3 changes c.50A>G, c.85A>G and c.141+14_+25dup12 on the same allele. Unknown if any of these has occurred de novo. Substitution of I29 has previously been noted (p.Ile29Ser) so c.85A>G may be the pathological mutation 1 - Female - Sporadic Unknown Yes Yes Nystagmus, cataract, foveal hypoplasia. -
+?/+? 05 Exon c.412A>G c.50A>G - p.(Asn17Ser) Asn (aac) > Ser (agc) predicted Predicted missense mutation PAX6_00849 50 TTGTCA A G CGGGCG Substitution PD Direct Sequencing - - - Patient 1 Aniridia [27081561], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female - Sporadic - - - Total aniridia, bilateral cataract, foveal hypoplasia -
+/+ 05 Exon - c.50dupA - p.(Asn17Lysfs*39) Frame-shifting insertion leading to PTC. NMD predicted. Protein synthesis unlikely PAX6_00920 50 TCTCAA - A CGGGCG Duplication PD Direct Sequencing - - - Family 1 III-2 Aniridia [28157223], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female - Familial - - - Aniridia, cataract, nystagmus, corneal opacity, microphthalmia -
+/+ 05 Exon c.413C>A c.51C>A - p.(Asn17Lys) Asn (aac) > Lys (aaa) predicted Paired domain missense mutation predicted PAX6_00600 51 TGTCAA C A GGGCGG Substitution PD Direct Sequencing - 0/200 - Jia et al Peters anomaly [20405024], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Chinese - - - - - Yes Bilateral Peters anomaly, congenital nystagmus, corneal leukoma with anterior synechia, anterior polar cataract, retinal hypoplasia, microphthalmia -
+/+ 05 Exon c.414G>A c.52G>A - p.(Gly18Arg) Gly (ggg) > Arg (agg) predicted Predicted missense mutation PAX6_00308 52 GTCAAC G A GGCGGC Substitution PD DHPLC - - - GRAAL Peters anomaly [12015275], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Male - Familial Yes No Yes Patient has bilateral Peters anomaly; father has Axenfeld-Rieger anomaly -
+/+ 05 Exon c.414G>T c.52G>T - p.(Gly18Trp) Gly (ggg) > Trp (ugg) predicted Predicted missense mutation PAX6_00117 52 GTCAAC G T GGCGGC Substitution PD SSCP - - - 205HD Congenital cataract [9792406], Germany:Mainz DNA SSCP - 1 - Female Familial Familial Unknown No n/a Secondary glaucoma. Mother with Peters anomaly has same mutation -
+/+ 05 Exon c.418G>C c.56G>C - p.(Arg19Pro) Arg (cgg) > Pro (ccg) predicted Predicted missense mutation PAX6_00289 56 AACGGG G C GCCACT Substitution PD SSCP, DGGE - - - 98/217 Partial Aniridia, Microphthalmia, Cataract [12634864] [24033328], United Kingdom (Great Britain):Edinburgh DNA DGGE, SSCP - 1 - Unknown - Familial Unknown No Yes Sclerocornea -
+/+ 05 Exon - c.57delG - p.(Pro20Hisfs*11) Frame-shifting deletion leading to PTC NMD predicted - protein synthesis unlikely PAX6_00782 57 CGGGCG G - CCACTG Deletion PD Direct Sequencing - - - 118 Aniridia [26661695], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male - Sporadic - - - Classical aniridia -
+/+ 05 Exon - c.63-70delGCCGGACT - p.Pro22Hisfs*31 Frame-shifting deletion leading to PTC NMD predicted - protein synthesis unlikely PAX6_00783 63 GCCACT GCCGGACT - CCACCC Deletion PD Direct Sequencing - - - 108 Aniridia [26661695], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male - Familial - - - Classical aniridia -
+/+ 05 Exon c.427insT c.65_66insT - p.(Asp23Glyfs*33) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00171 65 ACTGCC - T GGACTC Insertion PD Unknown - - - 367-97 Aniridia G Wildhart, unpublished, Germany:Mainz DNA Unknown - 1 - Female - Familial Unknown Unknown n/a - -
+/+ 05 Exon c.427del15 c.65_79del15 - p.(21_25del5) Predicted in-frame deletion Predicted deletion of 5 aa (PDSTR) from the first alpha helix of the N-terminal paired subdomain PAX6_00074 65 CACTGC CGGACTCCACCCGGC - AGAAGA Deletion PD SSCP, DGGE - - - E5del15 Aniridia [12634864], United Kingdom (Great Britain):Edinburgh DNA DGGE, SSCP This is patient 95/06 in Eur J Hum Genet 11 163-169. The mutation was confirmed independently - see Mol Cell Probes 11 287-292, patient LASER) 1 - Female - Familial Yes Unknown n/a - -
+/+ 05 Exon c.432delT c.70delT - p.(Ser24Profs*7) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00030 70 CCGGAC T - CCACCC Deletion PD Unknown - - - Bo Aniridia Glaser T et al (1995) Mol Genetics of Ocular Disease pp51-82, United Kingdom (Great Britain):Edinburgh DNA Unknown - 1 - Male - - Unknown Unknown n/a Son has typical aniridia; father has comparatively normal eyes - not diagnosed until age 51 -
+/+ 05 Exon c.434delC c.72delC - p.(Thr25Profs*6) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00414 72 GGATCT C - ACCCGG Deletion PD DHPLC - - - PY2K/372 PARTE Aniridia, Rieger anomaly K Williamson & V van Heyningen, unpublished, United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Female - - - - - Unusual bilateral iris colobomas, aniridia, Rieger anomaly -
+/+ 05 Exon c.434ins11 c.72_73ins11 - p.(Thr25Cysfs*10) Predicted frameshift leading to PTC - NMD likely Protein synthesis unlikely PAX6_00018 72 GACTCC - TGCGGACCTCC ACCCGG Insertion PD SSCP - - Insertion appears to be a duplication with an extra base added VMR1 Aniridia [7909985], United Kingdom (Great Britain):Edinburgh DNA SSCP Passed from females 7x and from males 6x in large pedigree 1 - Female - Familial Unknown Unknown n/a - -
+/+ 05 Exon c.438C>G c.76C>G - p.(Arg26Gly) Arg (cgg) > Gly (ggg) predicted Arg26Gly protein has reduced DNA binding activity (Hum Mol Gen 6, 381, 1997) PAX6_00035 76 TCCACC C G GGCAGA Substitution PD Direct Sequencing - - Substitution of arginine by glycine near N-terminal end of first alpha-helix; important for DNA binding SOBHA (II-3) Peters anomaly [8162071], United Kingdom (Great Britain):Edinburgh DNA Direct Sequencing Patient has Peters anomaly, iris hypoplasia, posterior embryotoxon and glaucoma. Mother (I-2) and sister (II-2) with same mutation have iris hypoplasia and posterior embryotoxon 1 - Male Familial Familial Yes No Yes - -
+/+ 05 Exon c.439G>C c.77G>C - p.(Arg26Pro) Arg (CGG) > Pro (CCG) predicted Missense change predicted PAX6_00510 77 CCACCC G C GCAGAA Substitution PD Direct Sequencing - - - Patient 44 Variant aniridia [18483559], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - - - Familial - - - Daughter has ectopic pupils, iris atrophy, nystagmus and cataract. Mother has nystagmus, microcornea, iris coloboma, stromal atrophy, peripheral choroidal coloboma -
+/? 05 Exon - c.78delG - p.(Gln27Argfs*4) - - PAX6_00727 78 CACCCG G - CAGAAG Deletion - Direct Sequencing - - vassilievat 63AN Congenital aniridia [28321846], Russian Federation:Moscow DNA SEQ - 1 Russian male de novo Sporadic yes no - OU: complete aniridia, nystagmus, compensated glaucoma, cataract, keratopathy -
+/+ 05 Exon - c.79C>T
    + c.357+1G>A
- p.(Gln27*) Gln (cag) > Ter (uag) predicted NMD predicted - protein synthesis unlikely PAX6_00851 79 ACCCGG C T AGAAGA Substitution PD Direct Sequencing - - - Patient 3 - [27081561], United Kingdom (Great Britain):Edinburgh DNA SEQ Patient has two de novo mutations. Based on the phenotype, they are probably on the same allele, but this has not been confirmed. 1 - male - Sporadic - - - Total aniridia, bilateral cataract, foveal hypoplasia -
+/+ 05 Exon c.442delA c.80delA - p.(Gln27Argfs*4) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00227 80 CCCGGC A - GAAGAT Deletion PD SSCP, Heteroduplex Analysis - - - - Aniridia [10737978], United States: DNA SSCP, Heteroduplex Analysis P1 in Hum Mut 15 332-339 1 - - - Familial Yes Unknown Unknown - -
+/+ 05 Exon c.472ins31 c.80_110dup31 - p.(Arg38Glufs*28) Predicted frameshift leading to PTC - NMD likely Protein synthesis unlikely PAX6_00303 80 CGGGGC - +31 CCGGCC Duplication PD SSCP, DGGE - - Mutation is a precise duplication of bases 80-110 (ie an insertion of 31 bases) - Aniridia [12634864], United Kingdom (Great Britain):Edinburgh DNA DGGE, SSCP - 1 - - - - Unknown No n/a - -
+/+ 05 Exon - c.83_85delAGA - p.(Lys28del) In-frame deletion of one codon predicted Deletion of lysine from first helix of PD PAX6_00663 83 GGCAGA AGA - TTGTAG Deletion PD Direct Sequencing - - - 71158 Microcornea Wang 2012 [22893676], United Kingdom (Great Britain):Edinburgh DNA SEQ Affected father not tested 1 35 Chinese microcornea cases female - Familial - - - Bilateral microcornea (8 mm), ptosis, partial iris hypoplasia, mild optic nerve hypoplasia, foveal hypoplasia -
+/+ 05 Exon - c.83_85delAGA - p.(Lys28del) In-frame deletion of one codon predicted Deletion of lysine from first helix of PD PAX6_00664 83 GGCAGA AGA - TTGTAG Deletion PD Direct Sequencing - - - 71987 (III:2) Microcornea Wang 2012 [22893676], United Kingdom (Great Britain):Edinburgh DNA SEQ Affected dizygotic twin III:2 has same mutation. Affected father not tested. 1 35 Chinese microcornea patients male - Familial - - - Bilateral microcornea (9 mm), full iris with mild structural anomaly, foveal hypoplasia -
?/? 05 Exon - c.83_89delinsGA - p.(Lys28Argfs*26) - - PAX6_00933 - CCACTGCCGGACTCCACCCGGCAGA AGATTGT GA AGAGCTAGCTCACAGCGGGGCCCGG Insertion/Deletion - Direct Sequencing - - - - congenital aniridia Russian Federation:Moscow DNA SEQ - 1 - male - - Yes No - Congenital aniiridia, nystagmus, cataract, keratopathy, optic disc and fovea hypoplasia, epicanthus, ptosis -
+/+ 05 Exon c.447A>G c.85A>G
    + c.50A>G, c.141+14_+25dup12
- p.(Ile29Val) Ile (auu) > Val (guu) predicted Missense substitution of invariant isolecuine PAX6_00193 85 CAGAAG A G TTGTAG Substitution PD SSCP - - - Patient 1 Foveal Hypoplasia, Aniridia, Cataract, Nystagmus [9856761], United Kingdom (Great Britain):Edinburgh DNA SSCP Patient has 3 changes c.50A>G, c.85A>G and c.141+14_+25dup12 on the same allele. Unknown if any of these has occurred de novo. Substitution of I29 has previously been noted (p.Ile29Ser) so c.85A>G may be the pathological mutation 1 - Female - Sporadic Unknown Yes Yes Nystagmus, cataract, foveal hypoplasia. -
+/+ 05 Exon c.448T>G c.86T>G - p.(Ile29Ser) Ile (auu) > Ser (agu) predicted Substitution of invariant isoleucine predicted PAX6_00172 86 AGAAGA T G TTGTAG Substitution PD Unknown - - - 372-97 Aniridia G Wildhart, unpublished, Germany:Mainz DNA Unknown Isoleucine is conserved at this position (in the first alpha helix of the N-terminal subdomain) in all paired domains sequenced to date. 1 - Female - Sporadic Unknown Unknown Yes - -
+/+ 05 Exon - c.87_90dupTGTA - p.(Glu31Cysfs*26) Frame-shifting insertion predicted to introduce PTC NMD predicted - protein synthesis unlikely PAX6_00639 87 ATTGTA - TGTA GAGCTA Duplication PD Direct Sequencing - - - Case 3 Aniridia [22393275], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Korean male - Sporadic - - - Aniridia, nystagmus, cataract -
+/+ 05 Exon c.456C>G c.94C>G r.(spl)? p.(Leu32Val)/p.? Leu (cua) > Val (gua) predicted. Possible creation of splice donor predicted by in silico analysis Predicted missense change or splice mutation (outcome unknown) PAX6_00473 94 GTAGAG C G TAGCTC Substitution PD DHPLC - - - 166 Aniridia [18241071] , United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - - - Familial Y - - - -
+/+ 5 Exon c.457_467dupTAGCTCACAGC c.95_105dup11 - p.(Gly36*) Duplication of 11 bases predicted Protein synthesis unlikely PAX6_00668 95 GTAGAGC - - GGGGCCC Duplication PD Direct Sequencing - - de novo mutation II:1 Aniridia [24787241], China:Fuzhou DNA SEQ Same mutation present in the affected son of the proband but not in the proband's unaffected parents. 1 China male - Familial - - - Foveal hypoplasia, nystagmus and presenile cataracts -
+/+ 05 Exon c.459G>C c.97G>C - p.(Ala33Pro) Ala (gcu) > Pro (ccu) predicted Missense mutation predicted PAX6_00159 97 GAGCTA G C CTCACA Substitution PD SSCP - - Introduction of proline predicted to disrupt first alpha-helix of paired domain SACUP Congenital cataract, Partial aniridia [9931324], United Kingdom (Great Britain):Edinburgh DNA SSCP - 1 - Female Familial Familial Yes Unknown Yes Partial aniridia with significant iris remnants; congenital cataracts. Father (BACUP) similarly affected -
?/? 05 Exon - c.100dup - p.(His34Profs*22) - - PAX6_00937 - CGGCAGAAGATTGTAGAGCTAGCTC - C ACAGCGGGGCCCGGCCGTGCGACAT Duplication PD Direct Sequencing - - - - congenital aniridia Russian Federation:Moscow DNA SEQ - 1 - male - - Yes No - Congenital aniridia, nystagmus, cataract, keratopathy, optic nerve disc and fovea hypoplasia Hyposthenic back posture
+/+ 05 Exon - c.101dupA - p.(His34Glnfs*22) Frame-shifting insertion predicted to create PTC NMD predicted; protein synthesis unlikely PAX6_00623 101 AGCTCA - A CAGCGG Duplication PD Direct Sequencing - - - QT464 Aniridia [21850189], United Kingdom (Great Britain):Edinburgh DNA SEQ Mother and maternal grandfather also affected 1 Chinese male - Familial - - - Nystagmus, foveal hypoplasia, aniridia, punctate cataract -
+/+ 05 Exon c.429_439del11 c.103_113del11 - p.(Asp23Alafs*29) PTC predicted - NMD likely Protein synthesis unlikely PAX6_00413 103 CTGCCG GACTCCACCCG - GCAGAA Deletion PD DHPLC - - - PY2K/515 Aniridia [16712695], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - Male - Sporadic Yes - n/a - -
+/+ 05 Exon c.468G>A c.106G>A - p.(Gly36Arg) Gly (ggg) > Arg (agg) predicted Missense substitution of invariant glycine predicted PAX6_00364 106 CACAGC G A GGGCCC Substitution PD DHPLC - - - PY2K/457 2/1B Cataract, Iris anomaly Hingorani 2009 2/1B [19218613], United Kingdom (Great Britain):Edinburgh DNA DHPLC Patient 2/1B in Hingorani 2009; mother is patient 2/1A 1 - Female Familial Familial Yes No Yes Iris anomaly and early cataracts. Same mutation in similarly affected mother -
+/+ 05 Exon c.468G>T c.106G>T - p.(Gly36Trp) Gly (ggg) > Trp (ugg) predicted Predicted substitution of invariant glycine in paired domain PAX6_00415 106 CACAGC G T GGGCCC Substitution PD DHPLC - - - PY2K/015 AMBRI Aniridia, Glaucoma [16712695], United Kingdom (Great Britain):Edinburgh DNA DHPLC Alternate patient ID is MEP3-10 1 - Female - Familial Yes - Yes Glaucoma secondary to bilateral aniridia. Probable familial case - deceased father had nystagmus and unilateral retinal detachment -
1 - 100
[<-] 1 2 3 4 5 6 ... [->] [>>]

Save Click here to save this list in a tab-delimited text file.

Legend: [ PAX6 full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Coding DNA Reference Sequence, with the first base of the Met-codon counted as position 1.
Path.: Variant pathogenicity, in the format Reported/Concluded; '+' indicating the variant is pathogenic, '+?' probably pathogenic, '-' no known pathogenicity, '-?' probably no pathogenicity, '?' effect unknown. Exon: Exon numbering. Each number covers the exon and the following intron. Exon 5a is classified as part of exon 05. Location: Location of the genomic change. Legacy DNA ID: Legacy mutation nomenclature using the original PAX6 cDNA numbering. DNA change: Variation at DNA level (see full legend for details and examples). RNA change: Variation at RNA level (see full legend for details and examples). Protein change: Variation at protein level (see full legend for details and examples). RNA information: Additional information about RNA change. Protein information: Additional information about protein change. PAX6 DB-ID: DataBase IDentifier; unique identifier for each mutation. Base number: Position of change within cDNA. 5' Sequence Context: Bases immediately 5' of the sequence change. Original Sequence: The original (wild type) sequence. Variant Sequence: The new (mutant or variant) sequence. 3' Sequence Context: Bases immediately 3' of the sequence change. Type: Type of variant at DNA level. Domain: PAX6 protein domain. Detection Method: Technique used to detect the mutation. RE Site: Variant creates (+) or destroys (-) a restriction enzyme recognition site. Frequency: Frequency of polymorphism or variant. Remarks: Other information. Patient ID: Internal patient reference Disease: Disease phenotype, as reported in paper/by submitter, unless modified by the curator. Reference/Submitter: Links to PubMed ID (if available) and Submitter ID Template: Variant detected in DNA, RNA and/or Protein. Technique: Technique used to detect the variation. # Reported: Number of times this case has been reported Population: Patient population Gender: Patient gender Sequence Inheritance: Sequence Inheritance Phenotype Inheritance: Phenotype Inheritance Second PCR: Second PCR CIS: Other Mutation in Cis Conserved residue: Variation affects conserved base or amino acid Related Phenotype: Related Phenotype Unrelated Phenotype: Unrelated Phenotype