This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

15 public entries
entries per page


Path. Hide Path. column Descending
Ascending

Exon Hide Exon column Descending
Ascending

Legacy DNA ID Hide Legacy DNA ID column Descending
Ascending

DNA change   Descending
Ascending

RNA change Hide RNA change column Descending
Ascending

Protein change Hide Protein change column Descending
Ascending

RNA information Hide RNA information column Descending
Ascending

Protein information Hide Protein information column Descending
Ascending

DB-ID Hide DB-ID column Descending
Ascending

Location Hide Location column Descending
Ascending

Base number Hide Base number column Descending
Ascending

5' Sequence Context Hide 5' Sequence Context column Descending
Ascending

Original Sequence Hide Original Sequence column Descending
Ascending

Variant Sequence Hide Variant Sequence column Descending
Ascending

3' Sequence Context Hide 3' Sequence Context column Descending
Ascending

Type Hide Type column Descending
Ascending

Domain Hide Domain column Descending
Ascending

Detection Method Hide Detection Method column Descending
Ascending

RE Site Hide RE Site column Descending
Ascending

Frequency Hide Frequency column Descending
Ascending

Remarks Hide Remarks column Descending
Ascending

Patient ID Hide Patient ID column Descending
Ascending

Disease Hide Disease column Descending
Ascending

Reference/Submitter Hide Reference/Submitter column Descending
Ascending

Template Hide Template column Descending
Ascending

Technique Hide Technique column Descending
Ascending

Remarks Hide Remarks column Descending
Ascending

# Reported Hide # Reported column Descending
Ascending

Population Hide Population column Descending
Ascending

Gender Hide Gender column Descending
Ascending

Sequence Inheritance Hide Sequence Inheritance column Descending
Ascending

Phenotype Inheritance Hide Phenotype Inheritance column Descending
Ascending

Second PCR Hide Second PCR column Descending
Ascending

CIS Hide CIS column Descending
Ascending

Conserved residue Hide Conserved residue column Descending
Ascending

Related Phenotype Hide Related Phenotype column Descending
Ascending

Unrelated  Phenotype Hide Unrelated  Phenotype column Descending
Ascending
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00011 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely - SOX2 Anophthalmia Syndrome [16283891], United Kingdom (Great Britain):Edinburgh DNA SSCA - 1 - female - Sporadic - - n/a Bilateral anophthalmia, congenital hip dislocation, mild facial dysmorphism. CT scan: rudimentary optic nerves, reduced corpus callosum, cystic dilatation of third ventricle -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00016 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Substitution NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Twin A Anophthalmia-Esophageal Syndrome [16892407 ], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Left anophthalmia, related facial asymmetry, cryptorchidism, tracheo-oesophageal fistula. Monozygotic twin has tracheo-oesophageal fistula and slightly reduced right palpebral fissure -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Predicted frameshift leading to PTC Truncated protein has impaired nuclear localization and no DNA binding or transactivation activity SOX2_00018 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 2 Anophthalmia, Microphthalmia, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh RNA SEQ - 1 - female Sporadic Sporadic - - n/a Left anophthalmia, right microphthalmia, hypogonadotropic hypogonadism, learning delay, brain anomalies by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00029 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Case 3 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ Protein change published as p.N24fs88X. HGVS nomenclature is p.Asn24ArgfsX65 1 - female Sporadic Sporadic - - n/a Right severe microphthalmia, left anterior segment dysgenesis and coloboma, tracheo-oesophageal fistula, oesophageal atresia, motor delay, speech delay, cognitive delay Horseshoe kidney (unclear if this is caused by SOX2 mutation - no obvious link to known expression pattern)
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00031 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Case 5 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ Protein change published as p.N24fs88X. HGVS nomenclature is p.Asn24ArgfsX65 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia. Normal cranial MRI, normal early development -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Predicted frameshifting deletion leading to PTC Truncated protein has impaired nuclear localisation, no DNA binding activity and no repression of beta-catenin-mediated transcription SOX2_00041 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deletion is in triplet repeat region - replication slippage likely P3 Anophthalmia, Hypopituitarism [18285410] , United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia, hypogonadotropic hypogonadism, arachnoid cyst by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00059 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Mutation inherited from unaffected mother Patient 2 Microphthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ Mother is an unaffected mosaic for the mutation. Patient's older sister with same mutation has unilateral anophthalmia and mental retardation. 1 Mixed population; patient is Hispanic female Familial (mother is mosaic) Sporadic Yes No - Bilateral severe microphthalmia. Head MRI revealed a hamartoma of the tuber cinereum. Developmental and motor delay. -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00060 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 3 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Mixed population; patient is Hispanic male Unknown Sporadic Yes No - Bilateral anophthalmia. Microcephaly. Micropenis and cryptorchidism. Motor and cognitive delay -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00061 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 4 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation is de novo in the patient. 1 Mixed ethnicity; patient is Caucasian male Sporadic Sporadic Yes No - Bilateral anophthalmia. Normal brain MRI. Foreskin adhesion. Toe syndactyly. Febrile seizures. Motor and developmental delay -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00068 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 1 SOX2 anophthalmia syndrome [20454695], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - - Right microphthalmia and optic nerve hypoplasia; normal left eye. Micropenis, cryptorchidism, prostatic utricle, pancreatic deficiency, low-set prominent ears, umbilical hernia, feeding disorder, global developmental delay -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00069 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Index case 2 Bilateral anophthalmia [20494911], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 50 Mexican subjects unknown unknown - - - - Bilateral anophthalmia. Partial agenesis of corpus callosum -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00074 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Case 3432 Unilateral anophthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation inherited from mother with right anophthalmia (left eye normal) 1 German male Familial Familial Yes No - Left anophthalmia, right eye normal. Delayed speech and motor development. Cavum vergae by MRI. -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Truncated protein predicted. Mutant protein has no in vitro transactivating activity SOX2_00105 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Suzuki 2014 Case 3 Bilateral anophthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ De novo mutation 1 - female Sporadic Sporadic - - - Retarded postnatal growth. Hamartoma by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00117 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Chacon-Camacho 2015 Anophthalmia, microphthalmia [26250054], United Kingdom (Great Britain):Edinburgh DNA SEQ Unaffected paernts do not have the mutation 1 - male Sporadic Sporadic - - - Left anophthalmia, right microphthalmia, dysmorphic features, small penis, dental gemination -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00120 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - - Ramirez-Botero 2016 Syndromic microphthalmia 3 (MCOPS3) [27206652], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents unaffected but not tested for mutation. Twin sister phenotypically unaffected. 1 - male - Sporadic - - - Bilateral microphthalmia, severe psychomotor and growth delay, brain anomalies by MRI, genital anomalies -
1 - 15

Save Click here to save this list in a tab-delimited text file.

Legend: [ SOX2 full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Coding DNA Reference Sequence, with the first base of the Met-codon counted as position 1.
Path.: Variant pathogenicity, in the format Reported/Concluded; '+' indicating the variant is pathogenic, '+?' probably pathogenic, '-' no known pathogenicity, '-?' probably no pathogenicity, '?' effect unknown. Exon: Exon number (always '01' for SOX2) Legacy DNA ID: This column is not used in the SOX2 database DNA change: Variation at DNA level (see full legend for details and examples). RNA change: Variation at RNA level (see Full Legend for examples) Protein change: Variation at protein level (see Full Legend for details and examples) RNA information: Additional information about RNA change Protein information: Additional information about protein change SOX2 DB-ID: Database IDentifier; unique identifier for each sequence variant Location: Variant location within the gene Base number: Position of change within cDNA 5' Sequence Context: Six bases immediately 5' of the change Original Sequence: The original (wild type) sequence Variant Sequence: The new (mutant or variant) sequence 3' Sequence Context: Six bases immediately 3' of the change Type: Type of variant at DNA level Domain: SOX2 protein domain: NTD (N-terminal domain), HMG (HMG box) or CTD (C-terminal domain) Detection Method: Technique used to detect the mutation RE Site: Variant creates (+) or destroys (-) a restriction enzyme recognition site Frequency: Frequency of polymorphism/variant Remarks: Any other comments Patient ID: Internal patient reference Disease: Disease phenotype, as reported in paper/by submitter, unless modified by the curator. Reference/Submitter: Links to PubMed ID (if available) and Submitter ID Template: Variant detected in DNA, RNA and/or Protein. Technique: Technique used to detect the variation. # Reported: Number of times this case has been reported Population: Patient population Gender: Patient gender Sequence Inheritance: Sequence Inheritance Phenotype Inheritance: Phenotype Inheritance Second PCR: Second PCR CIS: Other Mutation in Cis Conserved residue: Variation affects conserved base or amino acid Related Phenotype: Related Phenotype Unrelated Phenotype: Unrelated Phenotype