This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

Patient data (#0000857)
Patient ID -
Disease SOX2 Anophthalmia Syndrome
Reference/Submitter [16283891], United Kingdom (Great Britain):Edinburgh
Template DNA
Technique SSCA
Remarks -
# Reported 1
Population -
Gender female
Sequence Inheritance -
Phenotype Inheritance Sporadic
Second PCR -
Conserved residue n/a
Related Phenotype Bilateral anophthalmia, congenital hip dislocation, mild facial dysmorphism. CT scan: rudimentary optic nerves, reduced corpus callosum, cystic dilatation of third ventricle
Unrelated  Phenotype -
Submitter Isabel Hanson

Variant data
Allele Unknown
Reported pathogenicity Pathogenic
Concluded pathogenicity Pathogenic
Exon 01
Legacy DNA ID -
DNA change c.70_89del20
RNA change -
Protein change p.(Asn24Argfs*65)
RNA information Frameshifting deletion predicted
Protein information Frameshift PTC - truncated protein predicted
DB-ID SOX2_00011
Location Exon
Base number 70
5' Sequence Context GGCGGC
Variant Sequence -
3' Sequence Context CGGCGG
Type Deletion
Domain NTD
Detection Method Direct Sequencing
RE Site -
Frequency -
Remarks Deleted sequence is in triplet repeat region - replication slippage likely

1 entry in SOX2

Path. Allele
Exon Descending
Legacy DNA ID Descending
DNA change Descending
RNA change Descending
Protein change Descending
RNA information Descending
Protein information Descending
DB-ID Descending
Location Descending
Base number Descending
5' Sequence Context Descending
Original Sequence Descending
Variant Sequence Descending
3' Sequence Context Descending
Type Descending
Domain Descending
Detection Method Descending
RE Site Descending
Frequency Descending
Remarks Descending
+/+ Unknown 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00011 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely