This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

Patient data (#0000862)
Patient ID Twin A
Disease Anophthalmia-Esophageal Syndrome
Reference/Submitter [16892407 ], United Kingdom (Great Britain):Edinburgh
Template DNA
Technique SEQ
Remarks -
# Reported 1
Population -
Gender male
Sequence Inheritance Sporadic
Phenotype Inheritance Sporadic
Second PCR -
CIS -
Conserved residue n/a
Related Phenotype Left anophthalmia, related facial asymmetry, cryptorchidism, tracheo-oesophageal fistula. Monozygotic twin has tracheo-oesophageal fistula and slightly reduced right palpebral fissure
Unrelated  Phenotype -
Submitter Isabel Hanson

Variant data
Allele -
Reported pathogenicity Pathogenic
Concluded pathogenicity Pathogenic
Exon 01
Legacy DNA ID -
DNA change c.70_89del20
RNA change -
Protein change p.(Asn24Argfs*65)
RNA information Frameshifting deletion predicted
Protein information Frameshift PTC - truncated protein predicted
DB-ID SOX2_00016
Location Exon
Base number 70
5' Sequence Context GGCGGC
Original Sequence AACTCCACCGCGGCGGCGGC
Variant Sequence -
3' Sequence Context CGGCGG
Type Substitution
Domain NTD
Detection Method Direct Sequencing
RE Site -
Frequency -
Remarks Deleted sequence is in triplet repeat region - replication slippage likely

1 entry in SOX2

Path. Allele
Exon Descending
Ascending
Legacy DNA ID Descending
Ascending
DNA change Descending
Ascending
RNA change Descending
Ascending
Protein change Descending
Ascending
RNA information Descending
Ascending
Protein information Descending
Ascending
DB-ID Descending
Ascending
Location Descending
Ascending
Base number Descending
Ascending
5' Sequence Context Descending
Ascending
Original Sequence Descending
Ascending
Variant Sequence Descending
Ascending
3' Sequence Context Descending
Ascending
Type Descending
Ascending
Domain Descending
Ascending
Detection Method Descending
Ascending
RE Site Descending
Ascending
Frequency Descending
Ascending
Remarks Descending
Ascending
+/+ - 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00016 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Substitution NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely