This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

Patient data (#0001045)
Patient ID Patient 2
Disease Microphthalmia
Reference/Submitter [19921648], United Kingdom (Great Britain):Edinburgh
Template DNA
Technique SEQ
Remarks Mother is an unaffected mosaic for the mutation. Patient's older sister with same mutation has unilateral anophthalmia and mental retardation.
# Reported 1
Population Mixed population; patient is Hispanic
Gender female
Sequence Inheritance Familial (mother is mosaic)
Phenotype Inheritance Sporadic
Second PCR Yes
CIS No
Conserved residue -
Related Phenotype Bilateral severe microphthalmia. Head MRI revealed a hamartoma of the tuber cinereum. Developmental and motor delay.
Unrelated  Phenotype -
Submitter Isabel Hanson

Variant data
Allele Maternal (confirmed)
Reported pathogenicity Pathogenic
Concluded pathogenicity Pathogenic
Exon 01
Legacy DNA ID -
DNA change c.70_89del20
RNA change -
Protein change p.(Asn24Argfs*65)
RNA information Frameshifting deletion predicted
Protein information Frameshift PTC - truncated protein predicted
DB-ID SOX2_00059
Location Exon
Base number 70
5' Sequence Context GGCGGC
Original Sequence AACTCCACCGCGGCGGCGGC
Variant Sequence -
3' Sequence Context CGGCGG
Type Deletion
Domain N-terminal domain
Detection Method Direct Sequencing
RE Site -
Frequency -
Remarks Mutation inherited from unaffected mother

1 entry in SOX2

Path. Allele
Exon Descending
Ascending
Legacy DNA ID Descending
Ascending
DNA change Descending
Ascending
RNA change Descending
Ascending
Protein change Descending
Ascending
RNA information Descending
Ascending
Protein information Descending
Ascending
DB-ID Descending
Ascending
Location Descending
Ascending
Base number Descending
Ascending
5' Sequence Context Descending
Ascending
Original Sequence Descending
Ascending
Variant Sequence Descending
Ascending
3' Sequence Context Descending
Ascending
Type Descending
Ascending
Domain Descending
Ascending
Detection Method Descending
Ascending
RE Site Descending
Ascending
Frequency Descending
Ascending
Remarks Descending
Ascending
+/+ Maternal (confirmed) 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00059 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Mutation inherited from unaffected mother