This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

Patient data (#0001719)
Patient ID Suzuki 2014 Case 3
Disease Bilateral anophthalmia
Reference/Submitter [24804704], United Kingdom (Great Britain):Edinburgh
Template DNA
Technique SEQ
Remarks De novo mutation
# Reported 1
Population -
Gender female
Sequence Inheritance Sporadic
Phenotype Inheritance Sporadic
Second PCR -
Conserved residue -
Related Phenotype Retarded postnatal growth. Hamartoma by MRI
Unrelated  Phenotype -
Submitter Isabel Hanson

Variant data
Allele Unknown
Reported pathogenicity Pathogenic
Concluded pathogenicity Pathogenic
Exon 01
Legacy DNA ID -
DNA change c.70_89del20
RNA change -
Protein change p.(Asn24Argfs*65)
RNA information Frameshifting deletion predicted
Protein information Truncated protein predicted. Mutant protein has no in vitro transactivating activity
DB-ID SOX2_00105
Location Exon
Base number 70
5' Sequence Context GGCGGC
Variant Sequence -
3' Sequence Context CGGCGG
Type Deletion
Domain NTD
Detection Method Direct Sequencing
RE Site -
Frequency -
Remarks Deleted sequence is in triplet repeat region - replication slippage likely

1 entry in SOX2

Path. Allele
Exon Descending
Legacy DNA ID Descending
DNA change Descending
RNA change Descending
Protein change Descending
RNA information Descending
Protein information Descending
DB-ID Descending
Location Descending
Base number Descending
5' Sequence Context Descending
Original Sequence Descending
Variant Sequence Descending
3' Sequence Context Descending
Type Descending
Domain Descending
Detection Method Descending
RE Site Descending
Frequency Descending
Remarks Descending
+/+ Unknown 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Truncated protein predicted. Mutant protein has no in vitro transactivating activity SOX2_00105 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely