This database has been closed to new submissions.

LOVD - Variant listings for SOX2

About this overview [Show]

120 public entries
entries per page


Path. Hide Path. column Descending
Ascending

Exon Hide Exon column Descending
Ascending

Legacy DNA ID Hide Legacy DNA ID column Descending
Ascending

DNA change   Descending
Ascending

RNA change Hide RNA change column Descending
Ascending

Protein change Hide Protein change column Descending
Ascending

RNA information Hide RNA information column Descending
Ascending

Protein information Hide Protein information column Descending
Ascending

DB-ID Hide DB-ID column Descending
Ascending

Location Hide Location column Descending
Ascending

Base number Hide Base number column Descending
Ascending

5' Sequence Context Hide 5' Sequence Context column Descending
Ascending

Original Sequence Hide Original Sequence column Descending
Ascending

Variant Sequence Hide Variant Sequence column Descending
Ascending

3' Sequence Context Hide 3' Sequence Context column Descending
Ascending

Type Hide Type column Descending
Ascending

Domain Hide Domain column Descending
Ascending

Detection Method Hide Detection Method column Descending
Ascending

RE Site Hide RE Site column Descending
Ascending

Frequency Hide Frequency column Descending
Ascending

Remarks Hide Remarks column Descending
Ascending

Patient ID Hide Patient ID column Descending
Ascending

Disease Hide Disease column Descending
Ascending

Reference/Submitter Hide Reference/Submitter column Descending
Ascending

Template Hide Template column Descending
Ascending

Technique Hide Technique column Descending
Ascending

Remarks Hide Remarks column Descending
Ascending

# Reported Hide # Reported column Descending
Ascending

Population Hide Population column Descending
Ascending

Gender Hide Gender column Descending
Ascending

Sequence Inheritance Hide Sequence Inheritance column Descending
Ascending

Phenotype Inheritance Hide Phenotype Inheritance column Descending
Ascending

Second PCR Hide Second PCR column Descending
Ascending

CIS Hide CIS column Descending
Ascending

Conserved residue Hide Conserved residue column Descending
Ascending

Related Phenotype Hide Related Phenotype column Descending
Ascending

Unrelated  Phenotype Hide Unrelated  Phenotype column Descending
Ascending
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00001 Whole Gene - - - - - Deletion - FISH - - Patient has a 600kb deletion (encompassing the whole SOX2 gene) and a t(3;11) translocation Case 1 SOX2 Anophthalmia Syndrome [12612584], [15812812], [16529618], United Kingdom (Great Britain):Edinburgh DNA FISH - 1 - female Sporadic Sporadic n/a t(3;11) n/a Bilateral anophthalmia, mild facial dysmorphism, delayed motor milestones, decreased muscle tone, brain anomalies (MRI) -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00013 Whole Gene - - - - - Deletion - FISH - - Patient has a 2.7Mb deletion (encompassing the whole SOX2 gene) and a t(3;7) translocation Case 1 Anophthalmia-esophageal-genital syndrome [16543359], United Kingdom (Great Britain):Edinburgh DNA FISH Case first described by Rogers (1988) Proceedings of the Greenwood Genetic Center, 7, 57 1 - female Sporadic Sporadic - - - Bilateral anophthalmia, oesophageal atresia, tracheo-oesophageal fistula -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00034 Whole Gene - - - - - Deletion - MLPA - - ~328Kb deletion detected by MLPA and confirmed by FISH Case 8 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - male Sporadic Sporadic - - - Right anophthalmia, left cataract, seizures, brachycephaly, cryptorchidism, micropenis, delayed speech, delayed development -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00035 Whole Gene - - - - - Deletion - MLPA - - - Case 9 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - male Sporadic Sporadic - - - Severe bilateral microphthalmia, feeding difficulties. Normal cranial MRI -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00036 Whole Gene - - - - - Deletion - MLPA - - ~550Kb deletion detected by MLPA and confirmed by FISH Case 10 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - female Sporadic Sporadic - - - Bilateral microphthalmia with retinal detachments; perception of light maintained. Growth delay -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00037 Whole Gene - - - - - Deletion - MLPA - - - Case 11 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - female Sporadic Sporadic - - - Left anophthalmia, right mild optic disc dysplasia (normal vision), delayed puberty, delayed motor speech and cognitive development Ureteric reflux (unclear if this is caused by SOX2 mutation - no obvious link to known expression pattern)
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00038 Whole Gene - - - - - Deletion - MLPA - - - Case 12 SOX2 Anophthalmia Syndrome [17522144] , United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - female Sporadic Sporadic - - - Right anophthalmia, left microphthalmia with sclerocornea. normal early development -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00073 Whole Gene - - - - - Deletion - CGH - - 731 kb deletion Patient 1 Anophthalmia [21919124], United Kingdom (Great Britain):Edinburgh DNA SEQ Mother’s DNA normal; father unavailable 1 - female - Sporadic - - - Bilateral anophthalmia, developmental delay, hypogonadotropic hypogonadism, non-progressive pituitary tumour -
+/+ 01 - Whole gene deletion r.0 r.0 No transcription No translation SOX2_00084 Whole gene - - - - - Deletion - Other - - Deletion detcted by QMPSF Chassaing 2014 Patient 2 Anophthalmia/microphthalmia [24033328], United Kingdom (Great Britain):Edinburgh DNA Other Deletion detected by QMPSF. Absent in parents 1 - male Sporadic Sporadic - - - Pregnancy terminated at 30 weeks after detection of left anophthalmia. Right microphthalmia also found at autopsy. No cerebral abnormality. -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00109 Whole Gene - - - - - Deletion - CGH - - 2.3 Mb deletion Suzuki 2014 Case 7 Bilateral microphthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - - - - - Bilateral severe microphthalmia. Developmental delay, retarded postnatal growth, seizure. LH, FSH and GH deficiency. Ectopic posterior lobe by MRI -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00110 Whole Gene - - - - - Deletion - CGH - - 1.0 Mb deletion Suzuki 2014 Case 8 Bilateral anophthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - male - - - - - Developmental delay, retarded postnatal growth. LH, FSH and GH deficiency. Pituitary hypoplasia -
+/+ 01 - Whole gene deletion r.0 p.0 No transcription No translation SOX2_00111 Whole Gene - - - - - Deletion - CGH - - 2.5 Mb deletion Suzuki 2014 Case 9 Coloboma [24804704], United Kingdom (Great Britain):Edinburgh DNA CGH De novo deletion 1 - male Sporadic Sporadic - - - Right retinal fold, left optic disc coloboma. Developmental delay. LH and FSH deficiency. -
+/+ 01 - Whole gene deletion chr3:180,960,157-184,754,546 r.0 p.0 No transcription No translation SOX2_00083 Whole gene - - - - - Deletion - CGH - - - Chassaing 2014 Patient 1 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA CGH Deletion detected by QMPSF, confirmed by aCGH 1 - female - Sporadic - - - Bilateral anophthalmia, severe developmental delay, seizures, facial dysmorphism, small stature. Agenesis of the corpus callosum, optic nerve hypoplasia, and hypoplasia of the vermis by MRI -
+/+ 01 - Whole gene deletion chr3:181,012,354-185,302,035 r.0 p.0 No transcription No translation SOX2_00087 Whole gene - - - - - Deletion - Other - - Deletion detected by QMPSF Chassaing 2014 Patient 5 Microphthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA CGH 4.3 Mb deletion detected by QMPSF, confirmed by aCGH. Absent in parents 1 - female Sporadic Sporadic - - - Intrauterine fetal death at 30 weeks gestation. Oesophageal atresia, hemi-uterus, ante-positioned anus, left microphthalmia with sclerocornea (normal right eye; normal cerebral structures; normal growth). -
+/+ 01 - Whole gene deletion chr3:181,292,708_182,858,976 r.0 p.0 No transcription No translation SOX2_00124 Whole Gene - - - - - Deletion - CGH - - Patient has a 1.5-2Mb deletion Dennert et al 2017 Patient 3 Developmental delay [27862890], United Kingdom (Great Britain):Edinburgh DNA CGH - 1 - female - - - - - Developmental delay, hypogonadotrophic hypogonadism, mild facial dysmorphism -
+/+ 01 - Whole gene deletion chr3:181216930-189014508 r.0 p.0 No transcription No translation SOX2_00039 Whole Gene - - - - - Deletion - FISH - - Patient has a 7.8Mb deletion (detected by FISH, confirmed by CGH) Patient 1 Anophthalmia, Microphthalmia, Hypopituitarism [18285410], United Kingdom (Great Britain):Edinburgh DNA FISH - 1 - female Sporadic - - - - Right anophthalmia, left microphthalmia, mild pulmonary stenosis, pituitary anomalies, global developmental delay, brain anomalies by MRI -
+/+ 01 - Whole gene deletion chr3:181225746_181460587 r.0 p.0 No transcription No translation SOX2_00123 Whole Gene - - - - - Deletion - CGH - - Patient has a 235kb deletion Dennert et al 2017 Patient 2 Intellectual disability [27862890], United Kingdom (Great Britain):Edinburgh DNA CGH De novo deletion 1 - female Sporadic Sporadic - - - - Moderate intellectual disability, dysmorphic features, oesophageal dysfunction
+/+ 01 - Whole gene deletion chr3:182,775,402-183,101,622 r.0 p.0 No transcription No translation SOX2_00085 Whole gene - - - - - Deletion - Other - - Detected by QMPSF Chassaing 2014 Patient 3 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA CGH Deletion detected by QMPSF, confirmed by aCGH 1 - male - Sporadic - - - Bilateral anophthalmia, developmental delay, small stature. Hypoplasia of the corpus callosum and periventricular heterotopia by MRI. -
+/+ 01 - Whole gene deletion chr3:182,877,971-182,958,506 r.0 p.0 No transcription No translation SOX2_00086 Whole gene - - - - - Deletion - Other - - Detected by QMPSF Chassaing 2014 Patient 4 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA CGH 80kb deletion detected by QMPSF, confirmed by aCGH. Absent in parents 1 - male Sporadic Sporadic - - - Bilateral anophthalmia, micropenis, severe developmental delay, short stature secondary to GH insufficiency. Normal MRI -
+/+ 01 - Whole gene deletion chr3:182649000-184339000 r.0 p.0 No transcription No translation SOX2_00081 Whole Gene - - - - - Deletion - CGH - - 1.6 Mb deletion (encompassing the whole SOX2 gene) Case 2850 Bilateral anophthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA CGH Deletion absent in unaffected parents 1 - female - Sporadic - - - Bilateral anophthalmia. Pineal cyst by MRI. Normal development -
+/+ 01 - 3' gene deletion r.? p.? Effect on transcription unknown Effect on translation unknown SOX2_00033 Exon - - - - - Deletion Unknown MLPA - - 3' end of gene deleted; proximal breakpoint between bases 154-698 Case 7 Anophthalmia [17522144] , United Kingdom (Great Britain):Edinburgh DNA MLPA - 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia -
+/+ 01 - c.16G>T - p.(Glu6*) Glu (gag) > Ter (uag) predicted Termination of translation predicted SOX2_00058 ORF exon 16 ATGATG G T AGACGG Substitution N-terminal domain Direct Sequencing - - - Patient 1 Anophthalmia / microphthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female Unknown - - - - R anophthalmia, L microphthalmia + coloboma, glaucoma, and cataract. Some vision in the left eye. Vaginal adhesions. Small ears. Brain MRI normal. Delayed speech. ‘Drunken’ gait when walking. -
+/+ 01 - c.53C>A - p.(Ser18*) Ser (ucg) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00027 Exon 53 AAACTT C A GGGGGG Substitution NTD Direct Sequencing - - - Case 1 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia, mild lower limb dystonia and spasticity, pituitary anomalies, brain anomalies (by MRI) -
+/+ 01 - c.53C>A - p.(Ser18*) Ser (ucg) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00114 Exon 53 AAACTT C A GGGGGG Substitution NTD Direct Sequencing - - - 93MAC Anophthalmia [25542770], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents negative for mutation 1 Caucasian male Sporadic - - - - Bilateral anophthalmia. Brain anomalies by MRI; epilepsy; hypogenitalism; vertebral anomalies. -
+/+ 01 - c.58_59dupGG - p.(Gly21Argfs*75) Predicted frame-shifting duplication of 2 bases Truncated protein predicted SOX2_00057 ORF exon 58 GGGGGG - GG CGGCGG Duplication N-terminal domain Direct Sequencing - - Replication slippage likely Pedace et al SOX2 Anophthalmia Syndrome [19254784], United Kingdom (Great Britain):Edinburgh DNA SEQ Proband conceived through intracytoplasmic sperm injection. 1 - male Sporadic Sporadic - - - R anophthalmia, L severe microphthalmia; micropenis. Mutation absent in unaffected parents and dizygotic female twin. -
+/+ 01 - c.62dupG - p.(Gly22Argfs*74) Predicted frameshift leading to PTC Truncated protein has impaired nuclear localization and no DNA binding or transactivation activity SOX2_00017 Exon 62 GGGCGG - G CGGCGG Duplication NTD Direct Sequencing - - - Patient 1 Anophthalmia, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ DNA change published as c.60insG. HGVS nomenclature is c.62dupG 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia, hypogonadotropic hypogonadism, oesophageal atresia, spastic diplegia, brain anomalies (by MRI) -
+/+? 01 - c.67_69dupGGC - p.(Gly33_Asn34insGly) In-frame duplication of 3 bases Insertion of Glycine in a run of Glycines SOX2_00065 ORF exon 67 GGCGGC - GGC AACTCC Duplication N-terminal domain Direct Sequencing - - - Patient 8 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ It is possible that this is not a pathological mutation. The run of glycines containing the amino acid insertion is highly variable in other species. An affected half-sibling (aborted) did not have the mutation. 1 Mixed ethnicity; patient is Hispanic male Unknown - Yes No - Bilateral anophthalmia. Panhypopituitarism. Facial dysmorphism. Acanthosis nigricans. Excess extra-axial fluid, ectopic neurohypophysis and pituitary hypoplasia by brain MRI. Global developmental delay and autistic features. -
+/+ 01 - c.67_89del23 - p.(Gly23Argfs*65) Frameshifting deletion predicted Truncated protein predicted SOX2_00007 Exon 67 GGCGGC GGCAACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD DHPLC - - Deleted sequence is in triplet repeat region - replication slippage likely Case 7 SOX2 Anophthalmia Syndrome [15812812], [16529618], United Kingdom (Great Britain):Edinburgh DNA DHPLC Case 7 in Ragge et al; Case 4 in Sisodiya et al. Protein change published as G23fs85X - HGVS nomenclature is p.Gly23ArgfsX65 1 - female Sporadic Sporadic Y - n/a Bilateral anophthalmia, severe learning delay, hypotonia, seizures, bilateral brain anomalies (MRI) -
+/+ 01 - c.70_86del17 - p.(Asn24Glyfs*66) Frame-shifting deletion predicted PTC predicted SOX2_00088 ORF exon 70 GGCGGC AACTCCACCGCGGCGGC - GGCCGG Deletion N-terminal Direct Sequencing - - - Chassaing 2014 Patient 6 AEG syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ A subsequent pregnancy was also affected and the foetus had the same mutation. Low-level maternal somatic mosaicism was detected, which presumably extended to the germline. 1 - female Familial Sporadic - - - Bilateral anophthalmia, type III esophageal atresia -
+/+ 01 - c.70_86del17 - p.(Asn24Glyfs*66) Frame-shifting deletion predicted PTC predicted SOX2_00098 ORF exon 70 GGCGGC AACTCCACCGCGGCGGC - GGCCGG Deletion NTD Direct Sequencing - - - Chassaing 2014 Patient 16 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male - Sporadic - - - Pregnancy terminated at 23.5 weeks following detection of bilateral anophthalmia and bilateral cleft lip and palate. No further malformations found at autopsy. -
+/+ 01 - c.70_86del17 - p.(Asn24Glyfs*66) Frame-shifting deletion predicted PTC predicted. Mutant protein has no in vitro transactivating activity SOX2_00106 ORF exon 70 GGCGGC AACTCCACCGCGGCGGC - GGCCGG Deletion N-terminal Direct Sequencing - - - Suzuki 2014 Case 4 Bilateral anophthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female - - - - - Retarded postnatal growth. LH, FSH and GH deficiency. Pituitary hypoplasia by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00011 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely - SOX2 Anophthalmia Syndrome [16283891], United Kingdom (Great Britain):Edinburgh DNA SSCA - 1 - female - Sporadic - - n/a Bilateral anophthalmia, congenital hip dislocation, mild facial dysmorphism. CT scan: rudimentary optic nerves, reduced corpus callosum, cystic dilatation of third ventricle -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00016 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Substitution NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Twin A Anophthalmia-Esophageal Syndrome [16892407 ], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Left anophthalmia, related facial asymmetry, cryptorchidism, tracheo-oesophageal fistula. Monozygotic twin has tracheo-oesophageal fistula and slightly reduced right palpebral fissure -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Predicted frameshift leading to PTC Truncated protein has impaired nuclear localization and no DNA binding or transactivation activity SOX2_00018 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 2 Anophthalmia, Microphthalmia, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh RNA SEQ - 1 - female Sporadic Sporadic - - n/a Left anophthalmia, right microphthalmia, hypogonadotropic hypogonadism, learning delay, brain anomalies by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00029 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Case 3 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ Protein change published as p.N24fs88X. HGVS nomenclature is p.Asn24ArgfsX65 1 - female Sporadic Sporadic - - n/a Right severe microphthalmia, left anterior segment dysgenesis and coloboma, tracheo-oesophageal fistula, oesophageal atresia, motor delay, speech delay, cognitive delay Horseshoe kidney (unclear if this is caused by SOX2 mutation - no obvious link to known expression pattern)
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00031 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Case 5 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ Protein change published as p.N24fs88X. HGVS nomenclature is p.Asn24ArgfsX65 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia. Normal cranial MRI, normal early development -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Predicted frameshifting deletion leading to PTC Truncated protein has impaired nuclear localisation, no DNA binding activity and no repression of beta-catenin-mediated transcription SOX2_00041 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deletion is in triplet repeat region - replication slippage likely P3 Anophthalmia, Hypopituitarism [18285410] , United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia, hypogonadotropic hypogonadism, arachnoid cyst by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00059 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Mutation inherited from unaffected mother Patient 2 Microphthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ Mother is an unaffected mosaic for the mutation. Patient's older sister with same mutation has unilateral anophthalmia and mental retardation. 1 Mixed population; patient is Hispanic female Familial (mother is mosaic) Sporadic Yes No - Bilateral severe microphthalmia. Head MRI revealed a hamartoma of the tuber cinereum. Developmental and motor delay. -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00060 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 3 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Mixed population; patient is Hispanic male Unknown Sporadic Yes No - Bilateral anophthalmia. Microcephaly. Micropenis and cryptorchidism. Motor and cognitive delay -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00061 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion N-terminal domain Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 4 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation is de novo in the patient. 1 Mixed ethnicity; patient is Caucasian male Sporadic Sporadic Yes No - Bilateral anophthalmia. Normal brain MRI. Foreskin adhesion. Toe syndactyly. Febrile seizures. Motor and developmental delay -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00068 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Patient 1 SOX2 anophthalmia syndrome [20454695], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - - Right microphthalmia and optic nerve hypoplasia; normal left eye. Micropenis, cryptorchidism, prostatic utricle, pancreatic deficiency, low-set prominent ears, umbilical hernia, feeding disorder, global developmental delay -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00069 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Index case 2 Bilateral anophthalmia [20494911], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 50 Mexican subjects unknown unknown - - - - Bilateral anophthalmia. Partial agenesis of corpus callosum -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00074 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Case 3432 Unilateral anophthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation inherited from mother with right anophthalmia (left eye normal) 1 German male Familial Familial Yes No - Left anophthalmia, right eye normal. Delayed speech and motor development. Cavum vergae by MRI. -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Truncated protein predicted. Mutant protein has no in vitro transactivating activity SOX2_00105 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Suzuki 2014 Case 3 Bilateral anophthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ De novo mutation 1 - female Sporadic Sporadic - - - Retarded postnatal growth. Hamartoma by MRI -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00117 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - Deleted sequence is in triplet repeat region - replication slippage likely Chacon-Camacho 2015 Anophthalmia, microphthalmia [26250054], United Kingdom (Great Britain):Edinburgh DNA SEQ Unaffected paernts do not have the mutation 1 - male Sporadic Sporadic - - - Left anophthalmia, right microphthalmia, dysmorphic features, small penis, dental gemination -
+/+ 01 - c.70_89del20 - p.(Asn24Argfs*65) Frameshifting deletion predicted Frameshift PTC - truncated protein predicted SOX2_00120 Exon 70 GGCGGC AACTCCACCGCGGCGGCGGC - CGGCGG Deletion NTD Direct Sequencing - - - Ramirez-Botero 2016 Syndromic microphthalmia 3 (MCOPS3) [27206652], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents unaffected but not tested for mutation. Twin sister phenotypically unaffected. 1 - male - Sporadic - - - Bilateral microphthalmia, severe psychomotor and growth delay, brain anomalies by MRI, genital anomalies -
+/+ 01 - c.86_95dup10 - p.(Asn33Glyfs*66) Frame-shifting duplication predicted PTC predicted SOX2_00089 ORF exon 86 CGGCGG CGGCCGGCGG CGGCCGGCGGCGGCCGGCGG CAACCA Duplication N-terminal Direct Sequencing - - - Chassaing 2014 Patient 7 Anophthalmia [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation occurred de novo 1 - female Sporadic Sporadic - - - Pregnancy terminated at 28 weeks following detection of bilateral anophthalmia. No other malformations detected upon autopsy. -
+/+ 01 - c.131C>G - p.(Pro44Arg) Pro (ccc) > Arg (cgc) predicted HMG missense mutation predicted SOX2_00066 ORF exon 131 AGCGGC C G CATGAA Substitution HMG Direct Sequencing - - - Patient 9 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation has occurred de novo in the patient. 1 Mixed ethnicity; patient is Caucasian male Sporadic Sporadic Yes No Yes L anophthalmia (right eye normal); microcephaly; micropenis; mild speech and motor delay; unsteady gait. -
+/+ 01 - c.138T>G - p.(Asn46Lys) Asn (aau) > Lys (aag) predicted Predicted missense change in HMG box SOX2_00012 Exon 138 CATGAA T G GCCTTC Substitution HMG DHPLC StuI+ - Mutation inherited from normal mother (presumed gonosomal mosaic) Patient 2 (II:6) Anophthalmia Syndrome [16470798], United Kingdom (Great Britain):Edinburgh DNA DHPLC An earlier pregnancy was terminated owing to severe hydrocephaly. Brain and eye defects were confirmed at autopsy. Mutation status unknown 1 - female Familial (mosaic) Sporadic Y - Y Bilateral anophthalmia with related facial dysmorphism, hypotonia. MRI: absent optic nerves and chiasm, otherwise normal. Normal mother has reduced levels of the mutation in blood and mouthwash DNA -
+/+ 01 - c.138_140dupTGC - p.(Ala47dup) In-frame insertion predicted Duplication of Ala 47 predicted in HMG domain SOX2_00075 ORF exon 138 CATGAA TGC TGCTGC CTTCAT Duplication HMG Direct Sequencing - - - Case 3194 Bilateral anophthalmia (24498598) , United Kingdom (Great Britain):Edinburgh DNA SEQ Healthy parents do not have the mutation 1 German male Sporadic Sporadic Yes No - Bilateral anophthalmia. Small posterior corpus callosum by MRI -
+/+ 01 - c.143_144delTCinsAA - p.(Phe48*) Phe (uuc) > Ter (uaa) predicted Premature termination of translation predicted within HMG domain. Truncated protein has impaired nuclear localisation and transcriptional control activity. SOX2_00071 ORF exon 143 ATGCCT TC AA ATGGTG Insertion/Deletion HMG Direct Sequencing - - - Patient 2 Bilateral anophthalmia [21919124], United Kingdom (Great Britain):London DNA SEQ Parental DNA unavailable 1 - male - - - - - Bilateral anophthalmia, hypogonadotrophic hypogonadism, micropenis, non-progressive pituitary tumour -
+/+? 01 - c.151T>C - p.(Trp51Arg) Trp (ugg) > Arg (cgg) predicted Missense change affecting highly conserved residue in HMG box SOX2_00090 ORF exon 151 ATGGTG T C GGTCCC Substitution HMG Direct Sequencing - - - Chassaing 2014 Patient 8 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male - Sporadic - - - Right anophthalmia, left colobomatous microphthalmia, developmental delay, micropenis, hypogonadism. Hypoplasia of the corpus callosum and posterior pituitary agenesis by MRI. -
+/+ 01 - c.158_174delinsATG - p.(Arg53Hisfs*37) Frame-shifting indel predicted PTC predicted SOX2_00091 ORF exon 158 GGTCCC GCGGGCAGCGGCGCAAG ATG ATGGCC Insertion/Deletion HMG Direct Sequencing - - - Chassaing 2014 Patient 9 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation occurred de novo 1 - male Sporadic Sporadic - - - Pregnancy terminated at 23 weeks following detection of bilateral anophthalmia and ventriculomegaly. Atresia of the aqueduct of Sylvius also detected upon autopsy. Subtle dysmorphic features. -
+/+ 01 - c.163C>T - p.(Gln55*) Gln (cag) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00014 Exon 163 CGCGGG C T AGCGGC Substitution HMG DHPLC - - - Case 2 Anophthalmia-Esophageal-Genital syndrome [16543359], [15346919], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - female Sporadic Sporadic Y - n/a Bilateral anophthalmia, oesophageal atresia -
+/+ 01 - c.181C>T - p.(Gln61*) Nonsense mutation Gln (cag) > Ter (tag) predicted Truncated protein does not bind DNA or repress beta-catenin-mediated trasncription SOX2_00040 Exon 181 ATGGCC C T AGGAGA Substitution HMG Direct Sequencing BfaI+ - - Patient 2 Anophthalmia, Hypopituitarism [18285410] , United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female Sporadic Sporadic - - n/a Bilateral anophthalmia, neurodevelopmental delay, hypogonadotropic hypogonadism -
+/+ 01 - c.188delA - p.(Asn63Thrfs*40) Predicted frameshift leading to PTC Truncated protein predicted SOX2_00028 Exon 188 AGGAGA A - CCCCAA Deletion HMG Direct Sequencing - - - Case 2 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ Protein change published as p.N63fs101X. HGVS nomenclature is p.Asn63ThrfsX40 1 - female Sporadic Sporadic - - n/a Right anterior segment dysgenesis, coloboma of optic nerve and retina. Left optic nerve hypoplasia. Thin corpus callosum by MRI -
+/+ 01 - c.200delA - p.(His67Profs*36) Frame-shifting deletion predicted PTC predicted SOX2_00092 ORF exon 200 AGATGC A - CAACTC Deletion HMG Direct Sequencing - - - Chassaing 2014 Patient 10 Anophthalmia [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation occurred de novo 1 - male Sporadic Sporadic - - - Pregnancy terminated at 24 weeks following detection of bilateral anophthalmia and hypotelorism. Autopsy showed bilateral extreme microphthalmia and bifid xiphoid process was noted. -
+/+ 01 - c.221G>C - p.(Arg74Pro) Arg (cgc) > Pro (ccc) predicted Missense change in HMG domain predicted SOX2_00015 Exon 221 GCAAGC G C CCTGGG Substitution HMG DHPLC - - - Case 3 Anophthalmia-Esophageal-Genital syndrome [16543359] , United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - female Sporadic Sporadic Y - Y Bilateral extreme microphthalmia, oesophageal atresia, tracheo-oesophageal fistula. CT scan: rudimentary globes and optic chiasm -
+/+ 01 - c.221G>C - p.(Arg74Pro) Arg (cgc) > Pro (ccc) predicted Missense change in HMG domain predicted SOX2_00093 Exon 221 GCAAGC G C CCTGGG Substitution HMG Direct Sequencing - - - Chassaing 2014 Patient 11 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female - Sporadic - - - Bilateral extreme microphthalmia, developmental delay, moderate intellectual impairment, hypogonadism. MRI normal. -
+/+ 01 - c.224T>A - p.(Leu75Gln) Leu (cug) > Gln (cag) predicted Missense protein has reduced DNA binding and transactivation activity SOX2_00026 Exon 224 AGCGCC T A GGGCGC Substitution HMG Direct Sequencing - 0/200 - - Anophthalmia, Hypopituitarism [17287405], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female - Sporadic - - - Right anophthalmia, left eye normal, hypogonadotropic hypogonadism -
+/+ 01 - c.235C>T - p.(Trp79Arg) ugg (Trp) > cgg (Arg) predicted Missense change predicted. Mutant protein has reduced in vitro transactivating activity SOX2_00103 ORF exon 235 GCCGAG T C GGAAAC Substitution HMG Direct Sequencing - - - Suzuki 2014 Case 1 Unilateral microphthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male - - - - - Right microphthalmia; left eye normal. Retarded postnatal growth, oesophageal atresia, LH and FSH deficiency. Arachnoid cyst by MRI. -
+/+ 01 - c.236G>C - p.(Trp79Ser) Trp (ugg) > Ser (ucg) predicted Substitution of invariant Trp predicted SOX2_00094 ORF exon 236 CCGAGT G C GAAACT Substitution HMG Direct Sequencing - - - Chassaing 2014 Patient 12 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation occurred de novo 1 - male Sporadic Sporadic - - - Bilateral anophthalmia, developmental delay, moderate intellectual impairment, supernumerary teeth, cleft palate. Normal cerebral MRI. -
+/+ 01 - c.244_245delTT - p.(Leu82Valfs*13) Frame-shifting deletion predicted Truncated protein predicted SOX2_00076 ORF exon 244 AAACTT TT - GTCGGA Deletion HMG Direct Sequencing - - - Case 2813 Bilateral anophthalmia (24498598) , United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 German male - Sporadic Yes No - Bilateral anophthalmia. Fronto-temporal cerebral reduction by MRI. Developmental delay -
+/+ 01 - c.244_245delTT - p.(Leu82Valfs*13) Frame-shifting deletion predicted Truncated protein predicted. Mutant protein has no in vitro transactivating activity SOX2_00107 ORF exon 244 AAACTT TT - GTCGGA Deletion HMG Direct Sequencing - - - Suzuki 2014 Case 5 Bilateral microphthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ De novo mutation 1 - female Sporadic Sporadic - - - Bilateral severe microphthalmia. Developmental delay, retarded postnatal growth, hemi-hypertrophy -
+/+ 01 - c.244_245delTT - p.(Leu82Valfs*13) Frame-shifting deletion predicted Truncated protein predicted SOX2_00113 ORF exon 244 AAACTT TT - GTCGGA Deletion HMG Direct Sequencing - - - 60A Anophthalmia [25542770], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Caucasian male Sporadic - - - - Bilateral anophthalmia. Reduced white matter, absent optic nerves and chiasm by MRI. Short palpebral fissures. Micropenis; cryptorchidism. Delayed psychomotor development. -
+/+ 01 - c.245delT - p.(Leu82Cysfs*20) Frame-shifting deletion predicted PTC predicted SOX2_00095 ORF exon 245 AACTTT T - GTCGGA Deletion HMG Direct Sequencing - - - Chassaing 2014 Patient 13 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents tested - de novo mutation 1 - female Sporadic Sporadic - - - Bilateral extreme microphthalmia, left renal pelvic dilatation, atrial septal defect, respiratory distress, developmental delay, small stature, facial dysmorphism. -
+/+ 01 - c.248C>A - p.(Ser83*) Set (ucg) > Ter (uag) predicted HMG nonsense mutation - truncated protein predicted SOX2_00003 Exon 248 TTTTGT C A GGAGAC Substitution HMG DHPLC - - - Case 3 SOX2 Anophthalmia Syndrome [12612584], [15812812], [16529618], United Kingdom (Great Britain):Edinburgh DNA DHPLC Case 3 in Ragge et al; Case 2 in Sisodiya et al 1 - female Sporadic Sporadic Y - n/a Right anophthalmia, left microphthalmia with persistent pupillary membrane, spastic diplegia, learning difficulties, seizures -
+/+ 01 - c.255_256delGGinsT - p.(Glu86Argfs*17) Frame-shifting indel predicted PTC predicted SOX2_00096 ORF exon 255 GGAGAC GG T AGAAGC Insertion/Deletion HMG Direct Sequencing - - - Chassaing 2014 Patient 14 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents tested - mutation occurred de novo 1 - male Sporadic Sporadic - - - Bilateral anophthalmia, developmental delay, small stature, bilateral cryptorchidism. Left cerebellar hemisphere hypoplasia and moderately enlarged lateral ventricles by MRI. -
+/+ 01 - c.277G>T - p.(Glu93*) Glu (gag) > Ter (uag) predicted HMG box nonsense mutation - truncated protein predicted SOX2_00002 Exon 272 ATCGAC G T AGGCTA Substitution HMG DHPLC MaeI+ - - Case 2 SOX2 Anophthalmia Syndrome [12612584], [15812812], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - female Sporadic Sporadic Y - - Right anophthalmia, left microphthalmia and sclerocornea. Proximal mypopathy, delayed motor milestones, normal intelligence -
+/+ 01 - c.277G>T - p.(Glu93*) Glu (gag) > Ter (uag) predicted HMG box nonsense mutation - truncated protein predicted SOX2_00082 Exon 272 ATCGAC G T AGGCTA Substitution HMG Direct Sequencing - - - Case 3797 Anophthalmia/microphthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 German female - Sporadic Yes No - Right anophthalmia, left microphthalmia and coloboma. Normal MRI; normal development -
+/+ 01 - c.277G>T - p.(Glu93*) Glu (gag) > Ter (uag) predicted HMG box nonsense mutation - truncated protein predicted SOX2_00112 Exon 272 ATCGAC G T AGGCTA Substitution HMG Direct Sequencing - - - 28A Anophthalmia/microphthalmia [25542770], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation absent from normal parents 1 - male Sporadic Sporadic - - - Right anophthalmia; left microphthalmia and sclerocornea. High forehead, narrow palate, micrognathia, spastic hypertonic ankles, bilateral genu valgum, clinodactyly, low weight and height. -
+/+ 01 - c.285dupG - p.(Arg96Alafs*14) Frameshifting insertion predicted Frameshift creates PTC - truncated protein predicted SOX2_00032 Exon 285 GCTAAG - G CGGCTG Duplication HMG Direct Sequencing - - - Case 6 Anophthalmia [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ Protein change published as p.K95fs109X. HGVS nomenclature is p.Arg96Alafs*14 1 - male Sporadic Sporadic - - n/a Bilateral anophthalmia -
+/+ 01 - c.290T>C - p.(Leu97Pro) Leu (cug) > Pro (ccg) missense change predicted Predicted amino acid substitution in HMG box SOX2_00008 Exon 290 AGCGGC T C GCGAGC Substitution HMG DHPLC - - - Case 8 SOX2 Anophthalmia Syndrome [15812812], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - female Sporadic Sporadic Y - Y Left microphthalmia, sclerocornea, aphakia; right severe microphthalmia. Learning disability, dyspraxia, limb hypotonia, truncal ataxia, febrile convulsions -
+/+ 01 - c.302A>G - p.(His101Arg) Missense change His (cac) > Arg (cgc) predicted Substitution of invariant amino acid in HMG domain predicted SOX2_00077 ORF exon 302 CGCTGC A G CATGAA Substitution HMG Direct Sequencing - - - Case 3171 Bilateral anophthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Croatian male - Sporadic Yes No Yes Bilateral anophthalmia. Small septum pellucidum cyst by MRI at 2 months of age -
+/+ 01 - c.310G>T - p.(Glu104*) Glu (gag) > Ter (uag) predicted Truncated protein predicted SOX2_00048 ORF exon 310 ATGAAG G T AGCACC Substitution CTD Heteroduplex Analysis - 0/80 - Patient 40A SOX2 syndrome [18385794], United Kingdom (Great Britain):Edinburgh DNA HD Mutation absent from parental DNA 1 - male Sporadic Sporadic - - - Bilateral anophthalmia, brain anomalies, hydrocephalus, short stature, developmental delay -
+/+ 01 - c.310G>T - p.(Glu104*) Glu (gag) > Ter (uag) predicted Truncated protein predicted SOX2_00097 ORF exon 310 ATGAAG G T AGCACC Substitution CTD Direct Sequencing - - - Chassaing 2014 Patient 15 AEG syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents tested - de novo mutation 1 - male Sporadic Sporadic - - - Left extreme microphthalmia, right anophthalmia, oesophageal stenosis, micropenis, developmental delay, seizures. -
+/+ 01 - c.329A>G - p.(Tyr110Cys) Tyr (uac) > Cys (ugc) predicted Missense mutation of invariant cysteine predicted. Mutatn protein has reduced DNA binding and transactivation activity SOX2_00102 ORF exon 329 ATAAAT A G CCGGCC Substitution - Direct Sequencing - 0/150 - Tagaki 2014 Hypogonadotropic hypogonadism (24457197), United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation not present in healthy parents 1 Japanese male Sporadic Sporadic - - - Hypogonadotropic hypogonadism; horizontal nystagmus; retinal detachment; generalised seizures -
+?/+? 01 - c.355C>T - p.(Pro112Leu) Pro (ccc) > Leu (cuc) Amino acid substitution predicted SOX2_00122 ORF exon 335 ACCGGC C T CCGGCG Substitution - Other - - Whole exome sequencing Dennert et al 2017 Patient 1 Intellectual disability [27862890], United Kingdom (Great Britain):Edinburgh DNA Other Whole exome sequencing 1 - male Sporadic Sporadic - - - Moderate/severe intellectual disability, dysmorphic features, oesophageal dysfunction -
+/+ 01 - c.368A>G - p.(Asp123Gly) Asp (gau) > Gly (ggu) predicted Missense substitution of highly conserved aspartate residue predicted SOX2_00056 ORF exon 368 AGAAGG A G TAAGTA Substitution C-terminal domain Direct Sequencing - - - IV.2 Anophthalmia [19471311], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation confirmed in 8 affected relatives in 4 generations. Phenotype highly variable and generally much milder than proband (IV.2). 8 - male Familial Familial - - Yes Bilateral anophthalmia; bilateral small optic nerves and chiasm; normal genitalia. Highly variable phenotype in other affected family members (including very mildly affected sib). -
+/+ 01 - c.368A>G - p.(Asp123Gly) Asp (gau) > Gly (ggu) predicted Missense substitution of highly conserved aspartate residue predicted SOX2_00078 ORF exon 368 AGAAGG A G TAAGTA Substitution C-terminal domain Direct Sequencing - - - Case 3227 Anophthalmia/microphthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation inherited from mother with bilateral coloboma of iris, retina and choroid 1 Austrian female Familial Familial Yes No Yes Right anophthalmia, left microphthalmia and retinal/choroidal coloboma. Delayed motor development. Normal MRI -
-/- 01 - c.387C>G
    + c.389G>C
- p.(=) Gly (ggc) > Gly (ggg) predicted No effect predicted SOX2_00024 Exon 387 GCCCGG C G GGGCTG Substitution CTD Direct Sequencing - 0/100 Variant inherited from unaffected father Patient 7 Optic nerve hypoplasia [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ Patient has inherited two apparently neutral variants from unaffected father 1 - female Familial Sporadic - Y Y Nystagmus, short stature -
+/+ 01 - c.387delC - p.(Leu131Cysfs*23 Predicted frameshift leading to PTC Truncated protein has impaired transactivation activity SOX2_00019 Exon 387 GCCCGG C - GGCTGC Deletion CTD Direct Sequencing - - - Patient 3 Microphthalmia, Coloboma, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Left microphthalmia, right coloboma, hypogonadotropic hypogonadism, cryptorchidism, micropenis, learning delay, mild spastic paraplegia, brain anomalies by MRI -
-/- 01 - c.389G>C
    + c.387C>G
- p.(Gly130Ala) Missense change Gly (ggg) > Ala (gcg) predicted Nuclear localization, DNA binding and transactivation activity unaffected SOX2_00023 Exon 389 CCGGCG G C GCTGCT Substitution CTD Direct Sequencing BssHII+ 0/100 Variant inherited from unaffected father Patient 7 Optic nerve hypoplasia [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ Patient has inherited two apparently neutral variants from unaffected father 1 - female Familial Sporadic - Y Y Nystagmus, short stature -
+/+ 01 - c.402delC - p.(Gly135Alafs*19) Frame-shifting deletion predicted Truncated protein predicted. Mutant protein has reduced in vitro transactivating activity SOX2_00108 ORF exon 402 GGCCCC C - GGCGGC Deletion CTD Direct Sequencing - - - Suzuki 2014 Case 6 Bilateral microphthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ Father is mosaic for the mutation 1 - female Familial (mosaic) Sporadic - - - Developmental delay, retarded postnatal growth. White matter signal anomaly by MRI -
-/- 01 - c.453G>A - p.(=) Ala (gcg) > Ala (gca) predicted No change expected SOX2_00045 Exon 453 GGGCGC G A GGCGTG Substitution CTD Direct Sequencing - - Presumed neutral variant - Unknown [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ Additional info kindly supplied by D. Kelberman 1 - - - - - - - - -
+/+ 01 - c.463C>T - p.(Gln155*) Gln (cag) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00010 Exon 463 GTGAAC C T AGCGCA Substitution CTD SSCP MaeI+ 0/142 - - SOX2 Anophthalmia Syndrome [16145681], United Kingdom (Great Britain):Edinburgh DNA SSCA - 1 - female Sporadic Sporadic - - n/a Moderate sensorineural hearing loss, severe learning and motor delay, limb contractures, no myopathy. MRI: absent optic chiasm and optic nerves, small superior colliculus, pineal cyst -
+/+ 01 - c.479delA - p.(Tyr160Serfs*4) Frameshifting deletion predicted Truncated protein has impaired transactivation activity SOX2_00022 Exon 479 ACAGTT A - CGCGCA Deletion CTD Direct Sequencing - - - Patient 6 Anophthalmia, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Bilateral anophthalmia, hypogonadotropic hypogonadism, small testes, micropenis, learning delay, sensorineural deafness, brain anomalies (by MRI) -
+/+ 01 - c.479dupA - p.(Tyr160*) Insertion creates immediate PTC Truncated protein has impaired transactivation activity SOX2_00020 Exon 479 CAGTTA - A CGCGCA Duplication CTD Direct Sequencing HpaI+ - - Patient 4 Microphthalmia, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Bilateral anophthalmia, hypogonadotropic hypogonadism, cryptorchidism, micropenis, severe learning delay, spastic and dystonic quadriparesis, brain anomalies by MRI -
+/+ 01 - c.479dupA - p.(Tyr160*) Insertion creates immediate PTC - SOX2_00118 Exon 479 CAGTTA - A CGCGCA Duplication CTD Direct Sequencing - - - Gorman 2016 Case 1 SOX2 Anophthalmia Syndrome, Status Dystonicus [27427475], United Kingdom (Great Britain):Edinburgh DNA SEQ Patient also has a 739kb deletion of Chr 1, inherited from phenotypically normal mother 1 - male Sporadic Sporadic - - - Complex phenotype including bilateral anophthalmia, global developmental delay, brain anomalies by MRI and bruxism. Status dystonicus preceded death in infancy -
+/+ 01 - c.479_480dupAC - p.(Ala161Thrfs*4) Frame-shifting insertion predicted Truncated protein predicted SOX2_00079 ORF exon 479 ACAGTT AC ACAC GCGCAC Substitution C-terminal Direct Sequencing - - - Case 3303 Anophthalmia/microphthalmia (24498598), United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation absent in unaffected parents 1 German female Sporadic Sporadic Yes No - Right anophthalmia, left microphthalmia and coloboma. Front cerebral volume reduction by MRI. Severe developmental delay -
+/+ 01 - c.480C>G - p.(Tyr160*) Tyr (uac) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00030 Exon 480 CAGTTA C G GCGCAC Substitution CTD Direct Sequencing - - - Case 4 SOX2 Anophthalmia Syndrome [17522144], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Right severe microphthalmia, left anophthalmia, micropenis, cryptorchidism -
+/+ 01 - c.480C>G - p.(Tyr160*) Tyr (uac) > Ter (uag) predicted Truncated protein predicted. Mutant protein has reduced in vitro transactivating activity SOX2_00104 Exon 480 CAGTTA C G GCGCAC Substitution CTD Direct Sequencing - - - Suzuki 2014 Case 2 Bilateral anophthalmia [24804704], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male - - - - - Dandy-Walker syndrome by MRI -
+/+ 01 - c.480C>G - p.(Tyr160*) Tyr (uac) > Ter (uag) predicted Nonsense PTC - truncated protein predicted SOX2_00119 Exon 480 CAGTTA C G GCGCAC Substitution CTD Direct Sequencing - - - Gorman 2016 Case 2 SOX2 Anophthalmia Syndrome [27427475], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - female Sporadic Sporadic - - - Complex phenotype including bilateral anophthalmia, global developmental delay, axial hypotonia, hearing loss, growth hormone deficiency and insomnia. Status dystonicus at age 6 -
?/? 01 - c.481G>T - p.(Ala161Ser) Ala (gcg) > Ser (ucg) predicted Missense change predicted (Ala is conserved at this position in all vertebrates) SOX2_00115 ORF exon 481 AGTTAC G T CGCACA Substitution - Direct Sequencing - - - 86MAC Microphthalmia [25542770], United Kingdom (Great Britain):Edinburgh DNA SEQ Unaffected daughter has same variant 1 Caucasian male Familial - - - Yes Mild left microphthalmia -
+/+ 01 - c.486_487dupCA - p.(Met163Thrfs*2) Predicted frameshifting insertion, followed immediately by termination codon. Termination of translation predicted SOX2_00062 ORF exon 486 CGCGCA - CA TGAACG Duplication C-terminal domain Direct Sequencing - - - Patient 5 Anophthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 Mixed ethnicity; patient is Caucasian male Sporadic Sporadic Yes No - Bilateral anophthalmia. Low growth hormone levels. Micropenis. Cavum septum pellucidum, non-specific periventricular white matter signal abnormality, and abnormal configuration of the pituitary and sellar structures by MRI. Gastric reflux. Global developmental delay -
+/+ 01 - c.513C>G - p.(Tyr171*) Nonsense mutation predicted PTC predicted SOX2_00099 ORF exon 513 CAGCTA C G AGCATG Substitution CTD Direct Sequencing - - - Chassaing 2014 Patient 17 Anophthalmia syndrome [24033328], United Kingdom (Great Britain):Edinburgh DNA SEQ Parents tested - de novo mutation 1 - female Sporadic Sporadic - - - Bilateral anophthalmia, developmental delay, language delay, hypogonadism, GH deficiency. Hypoplasia of the vermis and corpus callosum by MRI. -
+/+ 01 - c.529C>T - p.(Gln177*) Gln (cag) > Ter (uag) predicted Truncated protein predicted SOX2_00004 Exon 529 CAGGAC C T AGCTGG Substitution CTD DHPLC AvaI-, BfaI+ - - Case 4 SOX2 Anophthalmia Syndrome [12612584], [15812812], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - male Sporadic Sporadic Y - n/a Bilateral anophthalmia, hypotonia, delayed motor development, febrile convulsions -
+/+ 01 - c.529C>T - p.(Gln177*) Gln (cag) > Ter (uag) predicted Truncated protein predicted SOX2_00005 Exon 529 CAGGAC C T AGCTGG Substitution CTD DHPLC AvaI-, BfaI+ - - Case 5 SOX2 Anophthalmia Syndrome [12612584], [15812812], United Kingdom (Great Britain):Edinburgh DNA DHPLC - 1 - male Sporadic Sporadic Y - n/a Bilateral anophthalmia, microcephaly, micropenis, cryptorchidism, sensorineural deafness, learning difficulties -
+/+ 01 - c.529C>T - p.(Gln177*) Nonsense mutation predicted: Gln (cag) > Ter (uag) Truncated protein has impaired transactivation activity SOX2_00021 Exon 529 CAGGAC C T AGCTGG Substitution CTD Direct Sequencing MaeI+ - - Patient 5 Anophthalmia, Hypopituitarism [16932809], United Kingdom (Great Britain):Edinburgh DNA SEQ - 1 - male Sporadic Sporadic - - n/a Bilateral anophthalmia, hypogonadotropic hypogonadism, cryptorchidism, micropenis, severe learning delay, mild facial dysmorphism -
+/+ 01 - c.540C>G - p.(Tyr190*) Nonsense mutation Tyr (uac) > Ter (uag) predicted Truncated protein predicted SOX2_00063 ORF exon 540 GGGCTA C G CCGCAG Substitution C-terminal domain Direct Sequencing - - - Patient 6 Anophthalmia / microphthalmia [19921648], United Kingdom (Great Britain):Edinburgh DNA SEQ Mutation is de novo in the patient 1 Mixed ethnicity; patient is Caucasian male Sporadic Sporadic Yes No - L anophthalmia, R microphthalmia. Micropenis. Pyloric stenosis. Suprasellar mass, prominent spaces in posterior fossa, and cavum septum pellucidum by brain MRI. Tonic-clonic seizures. Delayed gross motor development. -
1 - 100
[<-] 1 2 [->]


Save Click here to save this list in a tab-delimited text file.

Legend: [ SOX2 full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Coding DNA Reference Sequence, with the first base of the Met-codon counted as position 1.
Path.: Variant pathogenicity, in the format Reported/Concluded; '+' indicating the variant is pathogenic, '+?' probably pathogenic, '-' no known pathogenicity, '-?' probably no pathogenicity, '?' effect unknown. Exon: Exon number (always '01' for SOX2) Legacy DNA ID: This column is not used in the SOX2 database DNA change: Variation at DNA level (see full legend for details and examples). RNA change: Variation at RNA level (see Full Legend for examples) Protein change: Variation at protein level (see Full Legend for details and examples) RNA information: Additional information about RNA change Protein information: Additional information about protein change SOX2 DB-ID: Database IDentifier; unique identifier for each sequence variant Location: Variant location within the gene Base number: Position of change within cDNA 5' Sequence Context: Six bases immediately 5' of the change Original Sequence: The original (wild type) sequence Variant Sequence: The new (mutant or variant) sequence 3' Sequence Context: Six bases immediately 3' of the change Type: Type of variant at DNA level Domain: SOX2 protein domain: NTD (N-terminal domain), HMG (HMG box) or CTD (C-terminal domain) Detection Method: Technique used to detect the mutation RE Site: Variant creates (+) or destroys (-) a restriction enzyme recognition site Frequency: Frequency of polymorphism/variant Remarks: Any other comments Patient ID: Internal patient reference Disease: Disease phenotype, as reported in paper/by submitter, unless modified by the curator. Reference/Submitter: Links to PubMed ID (if available) and Submitter ID Template: Variant detected in DNA, RNA and/or Protein. Technique: Technique used to detect the variation. # Reported: Number of times this case has been reported Population: Patient population Gender: Patient gender Sequence Inheritance: Sequence Inheritance Phenotype Inheritance: Phenotype Inheritance Second PCR: Second PCR CIS: Other Mutation in Cis Conserved residue: Variation affects conserved base or amino acid Related Phenotype: Related Phenotype Unrelated Phenotype: Unrelated Phenotype